Previous Contig 004600:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS058E05Sequence597004600 (4)gb:A83552_14509858e-66Sequence 1 from Patent WO9849330.
JMFS118B12Sequence626004600 (4)gb:BT002406_16360091e-34Arabidopsis thaliana Mg-chelatase, putative (At1g08520) mRNA, partial cds.
JMSF004F15Sequence245004600 (4)350012264 (2)gb:AF083555_17668941e-25Arabidopsis thaliana magnesium-chelatase subunit CHLD precursor, mRNA, nuclear g
JMSF022J17Sequence694004600 (4)gb:A83552_14509859e-68Sequence 1 from Patent WO9849330.796012264 (2)gb:A83552_14509853e-94Sequence 1 from Patent WO9849330.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022J17+ CCTCGATGAGN
                      ____________________________________________________________
consensus CCTCGATGAGN
 
. : . : . : . : . : . :
JMFS058E05+ CAGGTTGAAAAACAGTGGTTCCAGATTTCACAGACTCCTCAACATCA
JMSF022J17+ TCTGCCAGAAGGCCAGGTTGAAAAACAGTGGTTCCAGATTTCACAGACTCCTCAACATCA
                      ____________________________________________________________
consensus TCTGCCAGAAGGCCAGGTTGAAAAACAGTGGTTCCAGATTTCACAGACTCCTCAACATCA
 
. : . : . : . : . : . :
JMFS058E05+ ACTGATCCAATCAATCTATCTTCAGTTACACCAAGGGGAATCTGAACAAAAGGAGATTTA
JMSF022J17+ ACTGATCCAATCAATCTATCTTCAGTTACACCAAGGGGAATCTGAACAAAAGGAGATTTA
                      ____________________________________________________________
consensus ACTGATCCAATCAATCTATCTTCAGTTACACCAAGGGGAATCTGAACAAAAGGAGATTTA
 
. : . : . : . : . : . :
JMFS058E05+ ATTATCTCTGTCTTAATATTACCAGCGGAGTCATACTCTACTCTATCAGCAAGTCCATCT
JMSF022J17+ ATTATCTCTGTCTTAATATTACCAGCGGAGTCATACTCTACTCTATCAGCAAGTCCATCT
                      ____________________________________________________________
consensus ATTATCTCTGTCTTAATATTACCAGCGGAGTCATACTCTACTCTATCAGCAAGTCCATCT
 
. : . : . : . : . : . :
JMFS058E05+ TCCCACTCTTCAGGACAGGTAGGATCAGCATTTGAAATGGAGCCTTTAACTATTTCAATT
JMFS118B12+ ACTCTTCAGGACAGGTAGGATCAGCATTTGAAATGGAGCCTTTAACTATTTCAATT
JMSF022J17+ TCCCACTCTTCAGGACAGGTAGGATCAGCATTTGAAATGGAGCCTTTAACTATTTCAATT
                      ____________________________________________________________
consensus TCCCACTCTTCAGGACAGGTAGGATCAGCATTTGAAATGGAGCCTTTAACTATTTCAATT
 
. : . : . : . : . : . :
JMFS058E05+ GGAGGCAGAACTGCATGCAATCCACGAGCCATCACAGTTTTGGCCGTCCCACGTTTTCCA
JMFS118B12+ GGAGGCAGAACTGCATGCAATCCACGAGCCATCACAGTTTTGGCCGTCCCACGTTTTCCA
JMSF022J17+ GGAGGCAGAACTGCATGCAATCCACGAGCCATCACAGTTTTGGCCGTCCCACGTTTTCCA
                      ____________________________________________________________
consensus GGAGGCAGAACTGCATGCAATCCACGAGCCATCACAGTTTTGGCCGTCCCACGTTTTCCA
 
. : . : . : . : . : . :
JMFS058E05+ GATATCGCAATTCCTCCTATATTGCGGTCAATCGCCCCAAGTAGAAGAGCAGTTTTAATA
JMFS118B12+ GATATCGCAATTCCTCCTATATTGCGGTCAATCGCCCCAAGTAGAAGAGCAGTTTTAATA
JMSF022J17+ GATATCGCAATTCCTCCTATATTGCGGTCAATCGCCCCAAGTAGAAGAGCAGTTTTAATA
                      ____________________________________________________________
consensus GATATCGCAATTCCTCCTATATTGCGGTCAATCGCCCCAAGTAGAAGAGCAGTTTTAATA
 
. : . : . : . : . : . :
JMFS058E05+ GCATCCTGTCCGACGACGGCAGCTAAAGGGAAGTACTGCCTGCCGTAAGCAGTGGTGTCG
JMFS118B12+ GCATCCTGTCCGACGACGGCAGCTAAAGGGAAGTACTGCCTGCCGTAAGCAGTGGTGTCG
JMSF022J17+ GCATCCTGTCCGACGACGGCAGCTAAAGGGAAGTACTGCCTGCCGTAAGCAGTGGTGTCG
                      ____________________________________________________________
consensus GCATCCTGTCCGACGACGGCAGCTAAAGGGAAGTACTGCCTGCCGTAAGCAGTGGTGTCG
 
. : . : . : . : . : . :
JMFS058E05+ GCGGCGGGCTTCTGAGGCGCAGCGACGACGCTTCCGTTGGCACTGGCATTGATTCTGAAG
JMFS118B12+ GCGGCGGGCTTCTGAGGCGCAGCGACGACGCTTCCGTTGGCACTGGCATTGATTCTGAAG
JMSF022J17+ GCGGCGGGCTTCTGAGGCGCAGCGACGACGCTTCCGTTGGCACTGGCATTGATTCTGAAG
JMSF004F15+ TGAAG
                      ____________________________________________________________
consensus GCGGCGGGCTTCTGAGGCGCAGCGACGACGCTTCCGTTGGCACTGGCATTGATTCTGAAG
 
. : . : . : . : . : . :
JMFS058E05+ CGAAGCCTGTGTGGTCGTCGTCCTGAAGGCCTAAGAGAAGGAGTAGAGAGAGTGGGGAGC
JMFS118B12+ CGAAGCCTGTGTGGTCGTCGTCCTGAAGGCCTAAGAGAAGGAGTAGAGAGAGTGGGGAGC
JMSF022J17+ CGAAGCCTGTGTGGTCGTCGTCCTGAAGGCCTAAGAGAAGGAGTAGAGAGAGTGGGGAGC
JMSF004F15+ CGAAGCCTGTGTGGTCGTCGTCCTGAAGGCCTAAGAGAAGGAGTAGAGAGAGTGGGGAGC
                      ____________________________________________________________
consensus CGAAGCCTGTGTGGTCGTCGTCCTGAAGGCCTAAGAGAAGGAGTAGAGAGAGTGGGGAGC
 
. : . : . : . : . : . :
JMFS058E05+ AGAAACTTGAAGCGCAGAGTAGTGGAAAAGGGCGCAGTATGCGATGGATTCGCTGGTAAT
JMFS118B12+ AGAAACTTGAAGCGCAGAGTAGTGGAAAAGGGCGCAGTATGCGATGGATTCGCTGGTAAT
JMSF022J17+ AGAAACTTGAAGCGCAGAGTAGTGGAAAAGGGCGCAGTATGCGATGGATTCGCTGGTAAT
JMSF004F15+ AGAAACTTGAAGCGCAGAGTAGTGGAAAAGGGCGCAGTATGCGATGGATTCGCTGGTAAT
                      ____________________________________________________________
consensus AGAAACTTGAAGCGCAGAGTAGTGGAAAAGGGCGCAGTATGCGATGGATTCGCTGGTAAT
 
. : . : . : . : . : . :
JMFS058E05+ GTAGAAGAGA
JMFS118B12+ GTAGAAGAGAGCACCATTGGGCTACTGAAATGCGGAGAAGAAAGGGAAAGAGGAGGAAAG
JMSF022J17+ GTAGAAGAGAGCACCATTGGGCTACTGAAATGCGGAGAAGAAAGGGAAAGAGGAGGAAAG
JMSF004F15+ GTAGAAGAGAGCACCATTGGGCTACTGAAATGCGGAGAAGAAAGGGAAAGAGGAGGAAAG
                      ____________________________________________________________
consensus GTAGAAGAGAGCACCATTGGGCTACTGAAATGCGGAGAAGAAAGGGAAAGAGGAGGAAAG
 
. : . : . : . : . : . :
JMFS118B12+ AAGCA
JMSF022J17+ AAGCAGTGGTGATTGTTTTCT
JMSF004F15+ AAGCAGTGGTGATTGTTTTCTTATCTTGGATTTGCCAGTGTTATCGCCATTTGTCACTTC
                      ____________________________________________________________
consensus AAGCAGTGGTGATTGTTTTCTTATCTTGGATTTGCCAGTGTTATCGCCATTTGTCACTTC