Previous Contig 004596:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016P20Sequence545004596 (3)sp|Q94HF1|IF3B_ORYSA2e-65Eukaryotic translation initiation factor 3 subunit 11 (eIF-3 p25) (eIF3k).>gb:AC
JMFS116E06Sequence587004596 (3)sp|Q94HF1|IF3B_ORYSA5e-74Eukaryotic translation initiation factor 3 subunit 11 (eIF-3 p25) (eIF3k).>gb:AC
JMSF004E16Sequence279004596 (3)sp|Q94HF1|IF3B_ORYSA7e-18Eukaryotic translation initiation factor 3 subunit 11 (eIF-3 p25) (eIF3k).>gb:AC189008551 (67)gb:AY354208_16018152e-22Cucumis melo Hemed aminotransferase 1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS116E06+ AAGA
                      ____________________________________________________________
consensus AAGA
 
. : . : . : . : . : . :
JMFS116E06+ CCTTCAATGTTAATGGCCTCGGCAAGAACAGACCGAGGGACCTTTTGGTAGGTCAGTGAA
JMFF016P20+ GTAGGTCAGTGAA
                      ____________________________________________________________
consensus CCTTCAATGTTAATGGCCTCGGCAAGAACAGACCGAGGGACCTTTTGGTAGGTCAGTGAA
 
. : . : . : . : . : . :
JMFS116E06+ AGAACATGAATCGCATACATTTGAATTGCATGTTCAAAACCTGGCACAACTTCTACTATA
JMFF016P20+ AGAACATGAATCGCATACATTTGAATTGCATGTTCAAAACCTGGCACAACTTCTACTATA
                      ____________________________________________________________
consensus AGAACATGAATCGCATACATTTGAATTGCATGTTCAAAACCTGGCACAACTTCTACTATA
 
. : . : . : . : . : . :
JMFS116E06+ TGACGACTCTTAGCTGCCTCATCCCAAAATTGGCGGAATCTTGCTGTCTCCAAGTAGTGT
JMFF016P20+ TGACGACTCTTAGCTGCCTCATCCCAAAATTGGCGGAATCTTGCTGTCTCCAAGTAGTGT
                      ____________________________________________________________
consensus TGACGACTCTTAGCTGCCTCATCCCAAAATTGGCGGAATCTTGCTGTCTCCAAGTAGTGT
 
. : . : . : . : . : . :
JMFS116E06+ GAGAGAACAATTAGAGTCTTGAACTGTTCTTCCATTTGCACTCGTTCTGGGATTAAGAAA
JMFF016P20+ GAGAGAACAATTAGAGTCTTGAACTGTTCTTCCATTTGCACTCGTTCTGGGATTAAGAAA
                      ____________________________________________________________
consensus GAGAGAACAATTAGAGTCTTGAACTGTTCTTCCATTTGCACTCGTTCTGGGATTAAGAAA
 
. : . : . : . : . : . :
JMFS116E06+ AGACAAAGGCTGAAATCTGGCGCTGGCATGGCCATCAGAGCCTTGACCAAAATGCGAGCA
JMFF016P20+ AGACAAAGGCTGAAATCTGGCGCTGGCATGGCCATCAGAGCCTTGACCAAAATGCGAGCA
                      ____________________________________________________________
consensus AGACAAAGGCTGAAATCTGGCGCTGGCATGGCCATCAGAGCCTTGACCAAAATGCGAGCA
 
. : . : . : . : . : . :
JMFS116E06+ ACAATTTGTGTACTCATCCTCTCAGGCTCAAACTGATAAAGACGCAAAAGGCAAAGATTT
JMFF016P20+ ACAATTTGTGTACTCATCCTCTCAGGCTCAAACTGATAAAGACGCAAAAGGCAAAGATTT
JMSF004E16+ TCAGGCTCAAACTGATAAAGACGCAAAAGGCAAAGATTT
                      ____________________________________________________________
consensus ACAATTTGTGTACTCATCCTCTCAGGCTCAAACTGATAAAGACGCAAAAGGCAAAGATTT
 
. : . : . : . : . : . :
JMFS116E06+ GCATCCAAATTGTAAGTCTGCGAAGAAACCTGTTCATTGACGTAGTTCTCGAGATCAGGG
JMFF016P20+ GCATCCAAATTGTAAGTCTGCGAAGAAACCTGTTCATTGACGTAGTTCTCGAGATCAGGG
JMSF004E16+ GCATCCAAATTGTAAGTCTGCGAAGAAACCTGTTCATTGACGTAGTTCTCGAGATCAGGG
                      ____________________________________________________________
consensus GCATCCAAATTGTAAGTCTGCGAAGAAACCTGTTCATTGACGTAGTTCTCGAGATCAGGG
 
. : . : . : . : . : . :
JMFS116E06+ AGGATGTCTGGATTGTAAGGATTGACGACGATGAGTTGCTCCACCGTGTACGACAGCGCC
JMFF016P20+ AGGATGTCTGGATTGTAAGGATTGACGACGATGAGTTGCTCCACCGTGTACGACAGCGCC
JMSF004E16+ AGGATGTCTGGATTGTAAGGATTGACGACGATGAGTTGCTCCACCGTGTACGACAGCGCC
                      ____________________________________________________________
consensus AGGATGTCTGGATTGTAAGGATTGACGACGATGAGTTGCTCCACCGTGTACGACAGCGCC
 
. : . : . : . : . : . :
JMFS116E06+ GACGGCTGATTTTGTCCAGCCACCTCTCTCCCCATTTTCTGAAGCTTATTCAAACACGCA
JMFF016P20+ GACGGCTGATTTTGTCCAGCCACCTCTCTCCCCATTTTCTGAAGCTTATTCAAACACGCA
JMSF004E16+ GACGGCTGATTTTGTCCAGCCACCTCTCTCCCCATTTTCTGAAGCTTATTCAAACACGCA
                      ____________________________________________________________
consensus GACGGCTGATTTTGTCCAGCCACCTCTCTCCCCATTTTCTGAAGCTTATTCAAACACGCA
 
. : . : . : . : . : . :
JMFS116E06+ ACGCCCGCCGGTGAGATTTTTCGAGCTCAAGTTTACAGCTGCA
JMFF016P20+ ACGCCCGCCGGTGAGATTTTTCGAGCTCAAGTTTACAGCTGCAGAGGTTTCT
JMSF004E16+ ACGCCCGCCGGTGAGATTTTTCGAGCTCAAGTTTACAGCTGCAGAGGTTTCTAGGGCTTC
                      ____________________________________________________________
consensus ACGCCCGCCGGTGAGATTTTTCGAGCTCAAGTTTACAGCTGCAGAGGTTTCTAGGGCTTC