Previous Contig 004593:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN005C03Sequence544004593 (7)gb:BT003128_16367092e-34Arabidopsis thaliana At1g44770 mRNA, complete cds.
JMSF004E06Sequence478004593 (7)gb:BT003128_16367092e-13Arabidopsis thaliana At1g44770 mRNA, complete cds.
JMSF045L09Sequence814007686 (2)gb:AY039896_15604107e-74Arabidopsis thaliana At1g71810/F14O23_17 mRNA, complete cds.>gb:AY094006_1575512755004593 (7)gb:BT003128_16367091e-66Arabidopsis thaliana At1g44770 mRNA, complete cds.
JMSF046G08Sequence773004593 (7)gb:BT003128_16367098e-63Arabidopsis thaliana At1g44770 mRNA, complete cds.803004593 (7)gb:BT003128_16367094e-63Arabidopsis thaliana At1g44770 mRNA, complete cds.
JMSF047I05Sequence668004593 (7)gb:BT003128_16367096e-50Arabidopsis thaliana At1g44770 mRNA, complete cds.756004593 (7)gb:BT003128_16367093e-59Arabidopsis thaliana At1g44770 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047I05- TGCAATTATACAAAGATGGGAAATTTGGACACAACTATCTTCAAATTGCAGTCACAAC
                      ____________________________________________________________
consensus TGCAATTATACAAAGATGGGAAATTTGGACACAACTATCTTCAAATTGCAGTCACAAC
 
. : . : . : . : . : . :
rJMSF047I05- ACCAATTGTCATTAACAAATAACAAATTACAATCATCTGGAGTA-GGAACCCATTTCTGA
rJMSF045L09- ACAAATTACAATCATCTGGAGTAGGGAACCCATTTCTGA
rJMSF046G08- GGAACCCATTTCTGA
                      ____________________________________________________________
consensus ACCAATTGTCATTAACAAATAACAAATTACAATCATCTGGAGTAGGGAACCCATTTCTGA
 
. : . : . : . : . : . :
rJMSF047I05- GGAAAGAACAATCTTGATAGTATTTACAAGGGAGTTTAAATGACATATCGTACTGTACAC
rJMSF045L09- GGAAAGAACAATCTTGATAGTATTTACAAGGGAGTTTAAATGACATATCGTACTGTACAC
rJMSF046G08- GGAAAGAACAATCTTGATAGTATTTACAAGGGAGTTTAAATGACATATCGTACTGTACAC
                      ____________________________________________________________
consensus GGAAAGAACAATCTTGATAGTATTTACAAGGGAGTTTAAATGACATATCGTACTGTACAC
 
. : . : . : . : . : . :
rJMSF047I05- TTGCACACATACCAATTTGTTTGCTCAAAGGGCTCTCATAACCACTTTGCTGGTTGTATG
rJMSF045L09- TTGCACACATACCAATTTGTTTGCTCAAAGGGCTCTCATAACCACTTTGCTGGTTGTATG
rJMSF046G08- TTGCACACATACCAATTTGTTTGCTCAAAGGGCTCTCATAACCACTTTGCTGGTTGTATG
                      ____________________________________________________________
consensus TTGCACACATACCAATTTGTTTGCTCAAAGGGCTCTCATAACCACTTTGCTGGTTGTATG
 
. : . : . : . : . : . :
rJMSF047I05- TACCCCCTTAGCAGCAAGTTTCAGAACTGAGCGAGTGCTGTACAACCCTGCCAGAGCAAG
rJMSF045L09- TACCCCCTTAGCAGCAAGTTTCAGAACTGAGCGAGTGCTGTACAACCCTGCCAGAGCAAG
rJMSF046G08- TACCCCCTTAGCAGCAAGTTTCAGAACTGAGCGAGTGCTGTACAACCCTGCCAGAGCAAG
JMSF046G08+ GAGTGCTGTACAACCCTGCCAGAGCAAG
                      ____________________________________________________________
consensus TACCCCCTTAGCAGCAAGTTTCAGAACTGAGCGAGTGCTGTACAACCCTGCCAGAGCAAG
 
. : . : . : . : . : . :
rJMSF047I05- TCCCCATGTAGAGAGGGCATAAAACAACTTCCCTGCGTGCCAAATGTTGAACGCCGTCTC
rJMSF045L09- TCCCCATGTAGAGAGGGCATAAAACAACTTCCCTGCGTGCCAAATGTTGAACGCCGTCTC
rJMSF046G08- TCCCCATGTAGAGAGGGCATAAAACAACTTCCCTGCGTGCCAAATGTTGAACGCCGTCTC
JMSF046G08+ TCCCCATGTAGAGAGGGCATAAAACAACTTCCCTGCGTGCCAAATGTTGAACGCCGTCTC
                      ____________________________________________________________
consensus TCCCCATGTAGAGAGGGCATAAAACAACTTCCCTGCGTGCCAAATGTTGAACGCCGTCTC
 
. : . : . : . : . : . :
rJMSF047I05- CAACTTGTTCATGCCCCCCAGTCCTCTTTTCAAGGACTTCTGCAGCTGCTGGGGACTCAT
rJMSF045L09- CAACTTGTTCATGCCCCCCAGTCCTCTTTTCAAGGACTTCTGCAGCTGCTGGGGACTCAT
rJMSF046G08- CAACTTGTTCATGCCCCCCAGTCCTCTTTTCAAGGACTTCTGCAGCTGCTGGGGACTCAT
JMSF046G08+ CAACTTGTTCATGCCCCCCAGTCCTCTTTTCAAGGACTTCTGCAGCTGCTGGGGACTCAT
JMSF047I05+ CTTGTTCATGCCCCCCAGTCCTCTTTTCAAGGACTTCTGCAGCTGCTGGGGACTCAT
                      ____________________________________________________________
consensus CAACTTGTTCATGCCCCCCAGTCCTCTTTTCAAGGACTTCTGCAGCTGCTGGGGACTCAT
 
. : . : . : . : . : . :
rJMSF047I05- GTTCTGAGCTTTTGGGTTGGACAAAACACATCTAGCCATGAAGTTCGCAACTGCATCTAC
rJMSF045L09- GTTCTGAGCTTTTGGGTTGGACAAAACACATCTAGCCATGAAGTTCGCAACTGCATCTAC
rJMSF046G08- GTTCTGAGCTTTTGGGTTGGACAAAACACATCTAGCCATGAAGTTCGCAACTGCATCTAC
JMFN005C03+ AACACATCTAGCCATGAAGTTCGCAACTGCATTTAC
JMSF046G08+ GTTCTGAGCTTTTGGGTTGGACAAAACACATCTAGCCATGAAGTTCGCAACTGCATCTAC
JMSF047I05+ GTTCTGAGCTTTTGGGTTGGACAAAACACATCTAGCCATGAAGTTCGCAACTGCATCTAC
                      ____________________________________________________________
consensus GTTCTGAGCTTTTGGGTTGGACAAAACACATCTAGCCATGAAGTTCGCAACTGCATCTAC
 
. : . : . : . : . : . :
rJMSF047I05- AACCTGTTCCTCATTAACAATCACATAATTATCATTATCAATTCCGCTCCTTTCCTCAAC
rJMSF045L09- AACCTGTTCCTCATTAACAATCACATAATTATCATTATCAATTCCGCTCCTTTCCTCAAC
rJMSF046G08- AACCTGTTCCTCATTAACAATCACATAATTATCATTATCAATTCCGCTCCTTTCCTCAAC
JMFN005C03+ AACCTGTTCCTCATTAACAATCACATAATTATCATTATCAATTCCGCTCCTTTCCTCAAC
JMSF046G08+ AACCTGTTCCTCATTAACAATCACATAATTATCATTATCAATTCCGCTCCTTTCCTCAAC
JMSF047I05+ AACCTGTTCCTCATTAACAATCACATAATTATCATTATCAATTCCGCTCCTTTCCTCAAC
                      ____________________________________________________________
consensus AACCTGTTCCTCATTAACAATCACATAATTATCATTATCAATTCCGCTCCTTTCCTCAAC
 
. : . : . : . : . : . :
rJMSF047I05- ATTGCTCGGGACCATATCATCAGTTACCCAGACCCACCAACTTGGCTCTTCATGGTCAAT
rJMSF045L09- ATTGCTCGGGACCATATCATCAGTTACCCAGACCCACCAACTTGGCTCTTCATGGTCAAT
rJMSF046G08- ATTGCTCGGGACCATATCATCAGTTACCCAGACCCACCAACTTGGCTCTTCATGGTCAAT
JMFN005C03+ ATTGCTCGGGACCATATCATCAGTTACCCAGACCCACCAACTTGGCTCTTCATGGTCAAT
JMSF046G08+ ATTGCTCGGGACCATATCATCAGTTACCCAGACCCACCAACTTGGCTCTTCATGGTCAAT
JMSF047I05+ ATTGCTCGGGACCATATCATCAGTTACCCAGACCCACCAACTTGGCTCTTCATGGTCAAT
                      ____________________________________________________________
consensus ATTGCTCGGGACCATATCATCAGTTACCCAGACCCACCAACTTGGCTCTTCATGGTCAAT
 
. : . : . : . : . : . :
rJMSF047I05- TTTAATCAGAACTTCAG------------------CTGATGCCTCCTGGAACGGAAATTT
rJMSF045L09- TTTAATCAGAACTTCAGCTGTTTCCATGTCCACATCTGATGCCTCCTGGAACGGAAATTT
rJMSF046G08- TTTAATCAGAACTTCAGCTGTTTCCATGTCCACATCTGATGCCTCCTGGAACGGAAATTT
JMFN005C03+ TTTAATCAGAACTTCAGCTGTTTCCATGTCCACATCTGATGCCTCCTGGAACGGAAATTT
JMSF046G08+ TTTAATCAGAACTTCAGCTGTTTCCATGTCCACATCTGATGCCTCCTGGAACGGAAATTT
JMSF047I05+ TTTAATCAGAACTTCAG------------------CTGATGCCTCCTGGAACGGAAATTT
                      ____________________________________________________________
consensus TTTAATCAGAACTTCAGCTGTTTCCATGTCCACATCTGATGCCTCCTGGAACGGAAATTT
 
. : . : . : . : . : . :
rJMSF047I05- ACAAACAGCACCAGGTGCCGAATTTGGATGCAGAGATTCCAGTTGTTTCAAAAAGTTCGC
rJMSF045L09- ACAAACAGCACCAGGTGCCGAATTTGGATGCAGAGATTCCAGTTGTTTCAAAAAGTTCGC
rJMSF046G08- ACAAACAGCACCAGGTGCCGAATTTGGATGCAGAGATTCCAGTTGTTTCAAAAAGTTCGC
JMFN005C03+ ACAAACAGCACCAGGTGCCGAATTTGGATGCAGAGATTCCAGTTGTTTCAAAAAGTTCGC
JMSF046G08+ ACAAACAGCACCAGGTGCCGAATTTGGATGCAGAGATTCCAGTTGTTTCAAAAAGTTCGC
JMSF047I05+ ACAAACAGCACCAGGTGCCGAATTTGGATGCAGAGATTCCAGTTGTTTCAAAAAGTTCGC
JMSF004E06+ AAACAGCACCAGGTGCCGAATTTGGATGCAGAGATTCCAGTTGTTTCAAAAAGTTCGC
                      ____________________________________________________________
consensus ACAAACAGCACCAGGTGCCGAATTTGGATGCAGAGATTCCAGTTGTTTCAAAAAGTTCGC
 
. : . : . : . : . : . :
rJMSF047I05- AGAATCAACGGCAGAAAGCAGCTTATCATGGAGATCGGATGGGCAATCCTGCA
rJMSF045L09- AGAATCAACGGCAGAAAGCAGCTTATCATGGAGATCGGATGGGCAATCCTGCAATAATTT
rJMSF046G08- AGAATCAACGGCAGAAAGCAGCTTATCATGGAGATCGGATGGGCAATCCTGCAATAATTT
JMFN005C03+ AGAATCAACGGCAGAAAGCAGCTTATCATGGAGATCGGATGGGCAATCCTGCAATAATTT
JMSF046G08+ AGAATCAACGGCAGAAAGCAGCTTATCATGGAGATCGGATGGGCAATCCTGCAATAATTT
JMSF047I05+ AGAATCAACGGCAGAAAGCAGCTTATCATGGAGATCGGATGGGCAATCCTGCAATAATTT
JMSF004E06+ AGAATCAACGGCAGAAAGCAGCTTATCATGGAGATCGGATGGGCAATCCTGCAATAATTT
                      ____________________________________________________________
consensus AGAATCAACGGCAGAAAGCAGCTTATCATGGAGATCGGATGGGCAATCCTGCAATAATTT
 
. : . : . : . : . : . :
rJMSF045L09- AGGAGATTGCGAAATAGGCTGTAGAATATTCAGATTTTGTTCGAGCAGTTGCCTTA
rJMSF046G08- AGGAGATTGCGAAATAGGCTGTAGAATATTCAGATTTTGTTCGAGCAGTTGCCTTAGGCG
JMFN005C03+ AGGAGATTGCGAAATAGGCTGTAGAATATTCAGATTTTGTTCGAGCAGTTGCCTTAGGCG
JMSF046G08+ AGGAGATTGCGAAATAGGCTGTAGAATATTCAGATTTTGTTCGAGCAGTTGCCTTAGGCG
JMSF047I05+ AGGAGATTGCGAAATAGGCTGTAGAATATTCAGATTTTGTTCGAGCAGTTGCCTTAGGCG
JMSF004E06+ AGGAGATTGCGAAATAGGCTGTAGAATATTCAGATTTTGTTCGAGCAGTTGCCTTAGGCG
                      ____________________________________________________________
consensus AGGAGATTGCGAAATAGGCTGTAGAATATTCAGATTTTGTTCGAGCAGTTGCCTTAGGCG
 
. : . : . : . : . : . :
rJMSF046G08- TTGGTTTTCGGATCGCAAAGCCTCCAAATCTTCTTCTACTTTGTTCGTCTGAA
JMFN005C03+ TTGGTTTTCGGATCGCAAAGCCTCCAAATCTTCTTCTACTTTGTTCGTCTGAATTGACGG
JMSF046G08+ TTGGTTTTCGGATCGCAAAGCCTCCAAATCTTCTTCTACTTTGTTCGTCTGAATTGACGG
JMSF047I05+ TTGGTTTTCGGATCGCAAAGCCTCCAAATCTTCTTCTACTTTGTTCGTCTGAATTGACGG
JMSF004E06+ TTGGTTTTCGGATCGCAAAGCCTCCAAATCTTCTTCTACTTTGTTCGTCTGAATTGACGG
                      ____________________________________________________________
consensus TTGGTTTTCGGATCGCAAAGCCTCCAAATCTTCTTCTACTTTGTTCGTCTGAATTGACGG
 
. : . : . : . : . : . :
JMFN005C03+ CAGCGGCGGCGCCTCCTTGTGACCATCGTGGTGGTAGTGGTGACAGCATTCCACGGCGGC
JMSF046G08+ --GCGGCGGCGCCTCCTTGTGACCATCGTGGTGGTAGTGGTGACAGCATTCCACGGCGGC
JMSF047I05+ CAGCGGCGGCGCCTCCTTGTGACCATCGTGGTGGTAGTGGTGACAGCATTCCACGGCGGC
JMSF004E06+ CAGCGGCGGCGCCTCCTTGTGACCATCGTGGTGGTAGTGGTGACAGCATTCCACGGCGGC
                      ____________________________________________________________
consensus CAGCGGCGGCGCCTCCTTGTGACCATCGTGGTGGTAGTGGTGACAGCATTCCACGGCGGC
 
. : . : . : . : . : . :
JMFN005C03+ CCATGCCACGTCGGCCACCTCCAACACC
JMSF046G08+ CCATGCCACGTCGGCCACCTCCAACACCGTTTTCGCCACTTCAATTGGATGATTAACTTT
JMSF047I05+ CCATGCCACGTCGGCCACCTCCAACACCGTTTTCGCCACTTCAATTGGATGATTAACTTT
JMSF004E06+ CCATGCCACGTCGGCCACCTCCAACACCGTTTTCGCCACTTCAATTGGATGATTAACTTT
                      ____________________________________________________________
consensus CCATGCCACGTCGGCCACCTCCAACACCGTTTTCGCCACTTCAATTGGATGATTAACTTT
 
. : . : . : . : . : . :
JMSF046G08+ CATGGTTTCTCTCTGCAGACAAA
JMSF047I05+ CATGGTTTCTCTCTGCAGACAAA
JMSF004E06+ CATGGTTTCTCTCTGCAGACAAACAATCGCGCATATAATTTATTACGGAGTATATATGAA
                      ____________________________________________________________
consensus CATGGTTTCTCTCTGCAGACAAACAATCGCGCATATAATTTATTACGGAGTATATATGAA
 
. : . : . : . : . : . :
JMSF004E06+ TAGATGAATGGATTACGATAGAATCGCAGAGGTGGGAAACCCTAGGTTTGGTGGCGTGTC
                      ____________________________________________________________
consensus TAGATGAATGGATTACGATAGAATCGCAGAGGTGGGAAACCCTAGGTTTGGTGGCGTGTC