Previous Contig 004588:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033O08Sequence147004588 (33)596004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMFN001H04Sequence527004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMFN004C02Sequence596004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMFN017C04Sequence601004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMFN019E15Sequence599004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF003L10Sequence425003449 (10)gb:CQ785718_14527712e-35Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana 561004588 (33)gb:STU307031_17230414e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF004B09Sequence213005882 (14)gb:CTRCYC07A_16742457e-05Catharanthus roseus cyc07 gene, exon1-7, complete cds.122004588 (33)
JMSF004D11Sequence271004588 (33)sp|Q43517|FER1_LYCES1e-18Ferredoxin I, chloroplast precursor.>pir|T07175|T07175 ferredoxin [2Fe-2S] I pre232004588 (33)pir|A61291|A612919e-18ferredoxin [2Fe-2S] - parsley
JMSF009I21Sequence308004588 (33)sp|Q43517|FER1_LYCES6e-25Ferredoxin I, chloroplast precursor.>pir|T07175|T07175 ferredoxin [2Fe-2S] I pre572004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF011F23Sequence405004579 (4)gb:AF282858_17830301e-46Mesembryanthemum crystallinum histone deacetylase (Hdeac1) mRNA, complete cds.582004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF016J10Sequence574004588 (33)gb:STU307031_17230411e-36Solanum tuberosum mRNA for ferredoxin I (fed1 gene).725011898 (2)gb:AY087044_15720801e-65Arabidopsis thaliana clone 30996 mRNA, complete sequence.
JMSF025C01Sequence634004588 (33)gb:STU307031_17230412e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF027D20Sequence637004588 (33)gb:STU307031_17230412e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).587004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF030B03Sequence626004588 (33)gb:STU307031_17230412e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).585004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF030C23Sequence627004588 (33)gb:STU307031_17230412e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).579012703 (2)gb:AB061265_15220263e-13Solanum tuberosum StLTSR mRNA for low temperature and salt responsive protein, c
JMSF034F01Sequence637004588 (33)gb:STU307031_17230412e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).584004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF037B16Sequence638004588 (33)gb:STU307031_17230414e-49Solanum tuberosum mRNA for ferredoxin I (fed1 gene).586004588 (33)gb:STU307031_17230413e-49Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF038I01Sequence626004588 (33)gb:STU307031_17230412e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).586004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF040G07Sequence631004588 (33)gb:STU307031_17230412e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).585004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF041N23Sequence638004588 (33)gb:STU307031_17230412e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).587004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF044J20Sequence575004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF049G20Sequence634004588 (33)gb:STU307031_17230412e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).587004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041N23+ TTTTTTTTTGGGTGCAAAACTTAACAACATTTCATAT
JMSF037B16+ TTTTTTTTTTGGGTGCAAAACTTAACAACATTTCATAT
JMSF034F01+ TTTTTTTTTTGGTGCAAAACTTAACAACATTTCATAT
JMSF030B03+ GTGCAAAACTTAACAACATTTCATAT
JMSF049G20+ TGCAAAACTTAACAACATTTCATAT
JMSF038I01+ GCAAAACTTAACAACATTTCATAT
JMSF040G07+ GGTGCAAAACTTAACAACATTTCATAT
JMSF030C23+ TGCAAAACTTAACAACATTTCATAT
JMFN019E15+ CAAAACTTAACAACATTTCATAT
JMFN004C02+ GGTGCAAAACTTAACAACATTTCATAT
JMSF027D20+ TTTTTTTTTTGGTGCAAAACTTAACAACATTTCATAT
JMFN017C04+ CAACATTTCATAT
JMSF025C01+ AAAACTTAACAACATTTCATAT
                      ____________________________________________________________
consensus TTTTTTTTTTTGGTGCAAAACTTAACAACATTTCATAT
 
. : . : . : . : . : . :
rJMSF041N23- TAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMSF041N23+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF037B16- AGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF009I21- TAATGTATGGAAGAACTAAAACTCCATTGTTG
JMSF037B16+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMSF034F01+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMSF030B03+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMSF049G20+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMSF038I01+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF040G07- GAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMSF040G07+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMSF030C23+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMFN019E15+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF004D11- TATGGAAGAACNAANACTCCATTGTTG
rJMSF004B09- TGTTG
JMFN004C02+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMSF027D20+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMFN017C04+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMFN001H04+ AACTAAAACTCCATTGTTG
rJMFF033O08- ATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF038I01- AGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF030B03- GAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF034F01- AGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF027D20- GTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF049G20- TACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF011F23- CAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF044J20- AGATAATGTATGGAAGAACTAAAACTCCATTGTTG
rJMSF003L10- ATGGAAGAACTAAAACTCCATTGTTG
JMSF025C01+ TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
JMSF016J10+ TATGGAAGAACTAAAACTCCATTGTTG
                      ____________________________________________________________
consensus TAAATTGTAAATATAGAGCAAGTACAGATAATGTATGGAAGAACTAAAACTCCATTGTTG
 
. : . : . : . : . : . :
rJMSF041N23- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMSF041N23+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF037B16- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF009I21- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMSF037B16+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMSF034F01+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMSF030B03+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMSF049G20+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMSF038I01+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF040G07- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATAGATTAGA
JMSF040G07+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATAGATTAGA
JMSF030C23+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMFN019E15+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF004D11- TGGACAGGAAAATTACAGAATAATTAAATATATAATANATAAATACACTTATCGATTAGA
rJMSF004B09- TGGACAGGAAAATTACAGAATAGTTAAATATATAATAAATAAATACACTTATCGATTAGA
JMFN004C02+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMSF027D20+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMFN017C04+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMFN001H04+ TGGACAGGAAAATTCCAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMFF033O08- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF038I01- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF030B03- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF034F01- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF027D20- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF049G20- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF011F23- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF044J20- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
rJMSF003L10- TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMSF025C01+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
JMSF016J10+ TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
                      ____________________________________________________________
consensus TGGACAGGAAAATTACAGAATAATTAAATATATAATAAATAAATACACTTATCGATTAGA
 
. : . : . : . : . : . :
rJMSF041N23- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF041N23+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF037B16- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF009I21- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF037B16+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF034F01+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF030B03+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF049G20+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF038I01+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF040G07- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF040G07+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF030C23+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMFN019E15+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF004D11- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF004B09- CAATCTCTTCTTCCTTGTGGGTCTCAATGACGACGTT
JMFN004C02+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF027D20+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMFN017C04+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMFN001H04+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMFF033O08- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF038I01- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF030B03- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF034F01- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF027D20- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF049G20- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF011F23- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF044J20- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
rJMSF003L10- CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF025C01+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
JMSF016J10+ CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
                      ____________________________________________________________
consensus CAATCTCTTCTTCCTTGTGGGTCTCAATGACAACGTTAGACGTAGGGTAAGCGACGCAGG
 
. : . : . : . : . : . :
rJMSF041N23- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF041N23+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF037B16- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF009I21- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF037B16+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF034F01+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF030B03+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF049G20+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF038I01+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF040G07- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF040G07+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF030C23+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMFN019E15+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF004D11- TGAGGACGTANCCGGCGTCCATCTGCTCGTCCTCNAGGAAGCTGTTGTCGGACTGGTCGA
JMFN004C02+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF027D20+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMFN017C04+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMFN001H04+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMFF033O08- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF038I01- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF030B03- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF034F01- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF027D20- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF049G20- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF011F23- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF044J20- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
rJMSF003L10- TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF025C01+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
JMSF016J10+ TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
                      ____________________________________________________________
consensus TGAGGACGTAGCCGGCGTCCATCTGCTCGTCGTCGAGGAAGCTGTTGTCGGACTGGTCGA
 
. : . : . : . : . : . :
rJMSF041N23- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF041N23+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF037B16- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGTACGAGTACG
rJMSF009I21- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF037B16+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGTACGAGTACG
JMSF034F01+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF030B03+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF049G20+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF038I01+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF040G07- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF040G07+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF030C23+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMFN019E15+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF004D11- CGGTGCCGGANACCACCTTGCCGGC
JMFN004C02+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF027D20+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMFN017C04+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMFN001H04+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMFF033O08- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF038I01- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF030B03- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF034F01- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF027D20- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF049G20- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF011F23- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF044J20- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
rJMSF003L10- CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF025C01+ CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF016J10+ CGGTGCCGGAGA-CACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
JMSF009I21+ CGAGTACG
                      ____________________________________________________________
consensus CGGTGCCGGAGACCACCTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCACGAGTACG
 
. : . : . : . : . : . :
rJMSF041N23- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF041N23+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF037B16- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF009I21- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF037B16+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF034F01+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF030B03+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF049G20+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF038I01+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF040G07- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF040G07+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF030C23+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMFN019E15+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMFN004C02+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF027D20+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMFN017C04+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMFN001H04+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMFF033O08- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF038I01- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF030B03- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF034F01- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF027D20- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF049G20- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF011F23- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF044J20- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
rJMSF003L10- GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF025C01+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF016J10+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF009I21+ GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
JMSF004D11+ TCCAGAACGTAAACGTCGTCGGGGCAATCGA
                      ____________________________________________________________
consensus GGAGATCGGCCCCCAATTCCTCCGCCTGGTCCAGAACGTAAACGTCGTCGGGGCAATCGA
 
. : . : . : . : . : . :
rJMSF041N23- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF041N23+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF037B16- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF009I21- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF037B16+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF034F01+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF030B03+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF049G20+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF038I01+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF040G07- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF040G07+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF030C23+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMFN019E15+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMFN004C02+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF027D20+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMFN017C04+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMFN001H04+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMFF033O08- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF038I01- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF030B03- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF034F01- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF027D20- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF049G20- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF011F23- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF044J20- ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
rJMSF003L10- ACTCTAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF025C01+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF016J10+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF009I21+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
JMSF004D11+ ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
                      ____________________________________________________________
consensus ACTCGAAGTCCCCTGTCGGGGTCACCAGTTTCACCTTGTAAGACGCCATGCAGGTCATCC
 
. : . : . : . : . : . :
rJMSF041N23- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF041N23+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF037B16- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF009I21- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF037B16+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF034F01+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF030B03+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF049G20+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF038I01+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF040G07- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF040G07+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF030C23+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMFN019E15+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMFN004C02+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF027D20+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMFN017C04+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMFN001H04+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMFF033O08- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF038I01- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF030B03- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF034F01- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF027D20- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF049G20- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF011F23- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF044J20- GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
rJMSF003L10- GCCCCATGTTGCCGGATTTCAGCCCCNACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMFF033O08+ GCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF025C01+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF016J10+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF009I21+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
JMSF004D11+ GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
                      ____________________________________________________________
consensus GCCCCATGTTGCCGGATTTCAGCCCCAACTGCGCCGGCCGGAAGTTCGAGATGGCCCTCA
 
. : . : . : . : . : . :
rJMSF041N23- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF041N23+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF037B16- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF009I21- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF037B16+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF034F01+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF030B03+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF049G20+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF038I01+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF040G07- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF040G07+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF030C23+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMFN019E15+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMFN004C02+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF027D20+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMFN017C04+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMFN001H04+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMFF033O08- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF038I01- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF030B03- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF034F01- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF027D20- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF049G20- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF011F23- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF044J20- GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
rJMSF003L10- NGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMFF033O08+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF025C01+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF016J10+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF009I21+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
JMSF004D11+ GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
                      ____________________________________________________________
consensus GGCTGCCGCCCGCCGCCGCCGGCTTCCCGGACAGGAAGGAGGTGCTCATCATGCTGCCTG
 
. : . : . : . : . : . :
rJMSF041N23- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACA
JMSF041N23+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACA
rJMSF037B16- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
rJMSF009I21- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACATC
JMSF037B16+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
JMSF034F01+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
JMSF030B03+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
JMSF049G20+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
JMSF038I01+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
rJMSF040G07- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
JMSF040G07+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
JMSF030C23+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACT
JMFN019E15+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTT
JMFN004C02+ CGGAGAGAGTCGCCATTTTTTTCTTTTTC
JMSF027D20+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
JMFN017C04+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAG
JMFN001H04+ CGGAGAGAGTCGCCATTTTTTTCTTTTT
rJMFF033O08- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTT
rJMSF038I01- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
rJMSF030B03- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
rJMSF034F01- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
rJMSF027D20- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
rJMSF049G20- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
rJMSF011F23- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTT
rJMSF044J20- CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACT
rJMSF003L10- CNGANAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCA
JMFF033O08+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTT
JMSF025C01+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC
JMSF016J10+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACATC
JMSF009I21+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACATC
JMSF004D11+ CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACATC
                      ____________________________________________________________
consensus CGGAGAGAGTCGCCATTTTTTTCTTTTTCGATTCTTGGGTTAGTTGAGAATGGCAACTTC