Previous Contig 004579:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004B08Sequence239004579 (4)gb:AF282858_17830302e-06Mesembryanthemum crystallinum histone deacetylase (Hdeac1) mRNA, complete cds.241013713 (3)
JMSF010L03Sequence324004579 (4)gb:AF282858_17830306e-33Mesembryanthemum crystallinum histone deacetylase (Hdeac1) mRNA, complete cds.750011589 (3)
JMSF011F23Sequence405004579 (4)gb:AF282858_17830301e-46Mesembryanthemum crystallinum histone deacetylase (Hdeac1) mRNA, complete cds.582004588 (33)gb:STU307031_17230411e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).
JMSF037B15Sequence682004579 (4)gb:AF282858_1783030e-103Mesembryanthemum crystallinum histone deacetylase (Hdeac1) mRNA, complete cds.750011589 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037B15+ TGATGT
                      ____________________________________________________________
consensus TGATGT
 
. : . : . : . : . : . :
JMSF037B15+ ATGTCAATGTCTACATAGAGAACCCGCTCATGCACTTTGAGGAGCTCTAATATGGCAAGC
                      ____________________________________________________________
consensus ATGTCAATGTCTACATAGAGAACCCGCTCATGCACTTTGAGGAGCTCTAATATGGCAAGC
 
. : . : . : . : . : . :
JMSF037B15+ ACTATGTCATTCACATAGCAAAAACCAGATGCTTCGCATTTCTTGGCATGATGCAATCCA
                      ____________________________________________________________
consensus ACTATGTCATTCACATAGCAAAAACCAGATGCTTCGCATTTCTTGGCATGATGCAATCCA
 
. : . : . : . : . : . :
JMSF037B15+ CCAGCCCAGTTTATAGCAATATCACAATGTCCATGGTTTAATTTCACAGCCCCACCAACA
                      ____________________________________________________________
consensus CCAGCCCAGTTTATAGCAATATCACAATGTCCATGGTTTAATTTCACAGCCCCACCAACA
 
. : . : . : . : . : . :
JMSF037B15+ GAACCTCCTGCATAAGTTTGACAGAAAGAGTAGAGACCGTCGAAAACAGGGCAGTCCTCA
                      ____________________________________________________________
consensus GAACCTCCTGCATAAGTTTGACAGAAAGAGTAGAGACCGTCGAAAACAGGGCAGTCCTCA
 
. : . : . : . : . : . :
JMSF037B15+ CCAACATTAAATCGCTTCAACTGCCTCAGATTATCTTGCTGTGTTTCTGGAGTTATGCTT
JMSF011F23+ TCTGGAGTTATGCTT
                      ____________________________________________________________
consensus CCAACATTAAATCGCTTCAACTGCCTCAGATTATCTTGCTGTGTTTCTGGAGTTATGCTT
 
. : . : . : . : . : . :
JMSF037B15+ CTCAAGAAAGTAACATAGTCATCAGCATGAAACCTGCAAAGGTCCTTATCCCTTGCAGGA
JMSF011F23+ CTCGAGAAAGTAACATAGTCATCAGCATGAAACCTGCAAAGGTCCTTATCCCTTGCAGGA
                      ____________________________________________________________
consensus CTCGAGAAAGTAACATAGTCATCAGCATGAAACCTGCAAAGGTCCTTATCCCTTGCAGGA
 
. : . : . : . : . : . :
JMSF037B15+ TTAGGCTTGAGGACATGCATATGCTGTAGAAGTCCATAATGTGCAAGAAGAGCATGTGTC
JMSF010L03+ ACATGCATATGCTGTAGAAGTCCATAATGTGCAAGAAGAGCATGTGTC
JMSF011F23+ TTAGGCTTGAGGACATGCATATGCTGTAGAAGTCCATAATGTGCAAGAAGAGCATGTGTC
                      ____________________________________________________________
consensus TTAGGCTTGAGGACATGCATATGCTGTAGAAGTCCATAATGTGCAAGAAGAGCATGTGTC
 
. : . : . : . : . : . :
JMSF037B15+ ATCCGAATTCTGTGTGGCTTCATAGGGTGGCCTTGCCCATAATAATAATTCCCAACTTCT
JMSF010L03+ ATCCGAATTCTGTGTGGCTTCATAGGGTGGCCTTGCCCATAATAATAATTCCCAACTTCT
JMSF011F23+ ATCCGAATTCTGTGTGGCTTCATAGGGTGGCCTTGCCCATAATAATAATTCCCAACTTCT
                      ____________________________________________________________
consensus ATCCGAATTCTGTGTGGCTTCATAGGGTGGCCTTGCCCATAATAATAATTCCCAACTTCT
 
. : . : . : . : . : . :
JMSF037B15+ GGGTCATAGAAATAACTGACTTTTCGCTTCTTCCCATCTGGTCCAGACGGTAAGGAATTT
JMSF010L03+ GGGTCATAGAAATAACTGACTTTTCGCTTCTTCCCATCTGGTCCAGACGGTAAGGAATTT
JMSF011F23+ GGGTCATAGAAATAACTGACTTTTCGCTTCTTCCCATCTGGTCCAGACGGTAAGGAATTT
JMSF004B08+ GGTCATAGAAATAACTGACTTTTCGCTTCTTCCCATCTGGTCCAGACGGTAAGGAATTT
                      ____________________________________________________________
consensus GGGTCATAGAAATAACTGACTTTTCGCTTCTTCCCATCTGGTCCAGACGGTAAGGAATTT
 
. : . : . : . : . : . :
JMSF037B15+ CCTCCAGTATCCATCACCTGGTCTCAGTATAAAGACGGTTCCTGAGCTTAATCTCTAGAA
JMSF010L03+ CCTCCAGTATCCATCACCTGGTCTCAGTATAAAGACGGTTCCTGAGCTTAATCTCTAGAA
JMSF011F23+ CCTCCAGTATCCATCACCTGGTCTCAGTATAAAGACGGTTCCTGAGCTTAATCTCTAGAA
JMSF004B08+ CCTCCAGTATCCATCACCTGGTCTCAGTATAAAGACGGTTCCTGAGCTTAATCTCTAGAA
                      ____________________________________________________________
consensus CCTCCAGTATCCATCACCTGGTCTCAGTATAAAGACGGTTCCTGAGCTTAATCTCTAGAA
 
. : . : . : . : . : . :
JMSF037B15+ TGTTAAAGCAAGTATGGCCATCATCCACAACAAACTTTGAGCTAGCTTTGTTCCTCAGAG
JMSF010L03+ TGTTAAAGCAAGTATGGCCATCATCCACAACAAACTTTGAGCTAGCTTTGTTCCTCAGAG
JMSF011F23+ TGTTAAAGCAAGTATGGCCATCATCCACAACAAACTTTGAGCTAGCTTTGTTCCTCAGAG
JMSF004B08+ TGTTAAAGCAAGTATGGCCATCATCCACAACAAACTTTGAGCTAGCTTTGTTCCTCAGAG
                      ____________________________________________________________
consensus TGTTAAAGCAAGTATGGCCATCATCCACAACAAACTTTGAGCTAGCTTTGTTCCTCAGAG
 
. : . : . : . : . : . :
JMSF037B15+ TGATAAATAGAAGAC
JMSF010L03+ TGATAAATAGAAGAC
JMSF011F23+ TGATAAATAGAAGAC
JMSF004B08+ TGATAAATAGAAGACGTGAAAATGTGGGATGAACTCATAGAGACTCATATAGCCCATATC
                      ____________________________________________________________
consensus TGATAAATAGAAGACGTGAAAATGTGGGATGAACTCATAGAGACTCATATAGCCCATATC