Previous Contig 004577:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004B05Sequence295004577 (3)327009088 (3)gb:AP003770_18333272e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P055
JMSF022B05Sequence679004577 (3)764004577 (3)pir|T51269|T512692e-10hypothetical protein T8M16_140 - Arabidopsis thaliana>gb:ATT8M16_1556495 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022B05- GAACTTTAATGTTA
                      ____________________________________________________________
consensus GAACTTTAATGTTA
 
. : . : . : . : . : . :
rJMSF022B05- TTGTATGTTTACAGATCTTCCTCCTGTTTATGAAAAATAAAATTGTGCCTAGAGTCAGTA
                      ____________________________________________________________
consensus TTGTATGTTTACAGATCTTCCTCCTGTTTATGAAAAATAAAATTGTGCCTAGAGTCAGTA
 
. : . : . : . : . : . :
rJMSF022B05- ACGAAAAGGAAAACCACACACGCTGGTGATCCGAGTGTCTAGAGACAAAGCCTTCTCCTA
                      ____________________________________________________________
consensus ACGAAAAGGAAAACCACACACGCTGGTGATCCGAGTGTCTAGAGACAAAGCCTTCTCCTA
 
. : . : . : . : . : . :
rJMSF022B05- CATGCCTCGAAGGGGAGTGAAACCGTGCAAGGAGAGGAGGAGCCCAAGTCTTTAACGAGC
                      ____________________________________________________________
consensus CATGCCTCGAAGGGGAGTGAAACCGTGCAAGGAGAGGAGGAGCCCAAGTCTTTAACGAGC
 
. : . : . : . : . : . :
rJMSF022B05- TCTTGAATCAAGTCTGCACAGATGTAATCTTGTAAAACCAGTCCGATTTTTCCAGCCTCT
                      ____________________________________________________________
consensus TCTTGAATCAAGTCTGCACAGATGTAATCTTGTAAAACCAGTCCGATTTTTCCAGCCTCT
 
. : . : . : . : . : . :
rJMSF022B05- CTGTGCTCGCCGCAAGCTATGTCTCTGCACACTTCCTCCACGCTCTGAACCATCGCTTTG
                      ____________________________________________________________
consensus CTGTGCTCGCCGCAAGCTATGTCTCTGCACACTTCCTCCACGCTCTGAACCATCGCTTTG
 
. : . : . : . : . : . :
rJMSF022B05- CTGCACCACATTACAGGAGAGGCGGCAACTGCCCCTCGCTTTGTTCGGAAAGAACTCGTG
                      ____________________________________________________________
consensus CTGCACCACATTACAGGAGAGGCGGCAACTGCCCCTCGCTTTGTTCGGAAAGAACTCGTG
 
. : . : . : . : . : . :
rJMSF022B05- GTGAACTTGTTCAGAATACAGTTGGTATTACTGCCATCTGTCCCCCCTGCCTTCTTGCTC
                      ____________________________________________________________
consensus GTGAACTTGTTCAGAATACAGTTGGTATTACTGCCATCTGTCCCCCCTGCCTTCTTGCTC
 
. : . : . : . : . : . :
rJMSF022B05- CTTTGCACAATGTGGAGTGCAATATTGTCGTGAATTTTGCTCAAAGGTGGCGAACGACTT
JMSF022B05+ TGCACAATGTGGAGTGCAATATTGTCGTGAA-TTTGCTCAAAGGTGGCGAACGACTT
                      ____________________________________________________________
consensus CTTTGCACAATGTGGAGTGCAATATTGTCGTGAATTTTGCTCAAAGGTGGCGAACGACTT
 
. : . : . : . : . : . :
rJMSF022B05- ATCATCTGCTCGTCTAACACGCTGATCGGACTCAGAAGCTGATGCTCCGCCGTAGATTTG
JMSF022B05+ ATCATCTGCTCGTNTAACACGNTGATCGGACTCAGAAGCTGATGCTCCGCCGTAGATTTG
                      ____________________________________________________________
consensus ATCATCTGCTCGTCTAACACGCTGATCGGACTCAGAAGCTGATGCTCCGCCGTAGATTTG
 
. : . : . : . : . : . :
rJMSF022B05- TTTTTGCATGTTTCCACAGCCGCCGCCGCCGGCGGAGTGGATGCGCCGCTCGCCGATGAC
JMSF022B05+ TTTTTGCATGTTTCCACAGCCGCCGCCGCCGGCGGAGTGGATGCGCCGCTCGCCGATGAC
                      ____________________________________________________________
consensus TTTTTGCATGTTTCCACAGCCGCCGCCGCCGGCGGAGTGGATGCGCCGCTCGCCGATGAC
 
. : . : . : . : . : . :
rJMSF022B05- GACGACGACCCCACGGCCTTTATAATTTTCTTAAGCGCTTCCAAGTCTTGGTTGCACTTG
JMSF022B05+ GACGACGACCCCACGGCCTTTATAATTTTCTTAAGCGCTTCCAAGTCTTGGTTGCACTTG
                      ____________________________________________________________
consensus GACGACGACCCCACGGCCTTTATAATTTTCTTAAGCGCTTCCAAGTCTTGGTTGCACTTG
 
. : . : . : . : . : . :
rJMSF022B05- TCTAACGCCTTCAANAGCATCTTCCTCTTCACTTCCGTCAACGATGGGTTCTCCTTCCGC
JMSF022B05+ TCTAACGCCTTCAACAGCATCTTCCTCTTCACTTCCGTCAACGAT-GGTTCTCCTTCCGC
                      ____________________________________________________________
consensus TCTAACGCCTTCAACAGCATCTTCCTCTTCACTTCCGTCAACGATGGGTTCTCCTTCCGC
 
. : . : . : . : . : . :
rJMSF022B05- CGCAACCACCGGCGAGCACTTCTCCTCCAA
JMSF022B05+ CGCAACCACCGGCGAGCACTTCTCCTCCAACCCCATCAGCCGCACCACCAATGCGGAGGG
                      ____________________________________________________________
consensus CGCAACCACCGGCGAGCACTTCTCCTCCAACCCCATCAGCCGCACCACCAATGCGGAGGG
 
. : . : . : . : . : . :
JMSF022B05+ TCGAGTTTTTACTCCATTTTCAGCGGAGGCTCGACGGCGGAGCTCCGGTGGCAGAGCGGG
                      ____________________________________________________________
consensus TCGAGTTTTTACTCCATTTTCAGCGGAGGCTCGACGGCGGAGCTCCGGTGGCAGAGCGGG
 
. : . : . : . : . : . :
JMSF022B05+ ACTTCTCTGTACAATTACTTCAGCGTTATTATTCTGATCATCCACCGTCACTTTGTTGTT
JMSF004B05+ TCTGTACAATTACTTCAGCGTTATTATTCTGATCATCCACCGTCACTTTGTTGTT
                      ____________________________________________________________
consensus ACTTCTCTGTACAATTACTTCAGCGTTATTATTCTGATCATCCACCGTCACTTTGTTGTT
 
. : . : . : . : . : . :
JMSF022B05+ CGCCGGAGATGAATCTTCGCTGAATTTTCCTCGCTTTCCACCAGACGTAAGGCGTTTGGT
JMSF004B05+ CGCCGGAGATGAATCTTCGCTGAATTTTCCTCGCTTTCCACCAGACGTAAGGCGTTTGGT
                      ____________________________________________________________
consensus CGCCGGAGATGAATCTTCGCTGAATTTTCCTCGCTTTCCACCAGACGTAAGGCGTTTGGT
 
. : . : . : . : . : . :
JMSF022B05+ TCTGCTTTGGTATTTGGAGATGAGGTGAAAGATTCCGGACATGCAACCGACGGATTTCTC
JMSF004B05+ TCTGCTTTGGTATTTGGAGATGAGGTGAAAGATTCCGGACATGCAACCGACGGATTTCTC
                      ____________________________________________________________
consensus TCTGCTTTGGTATTTGGAGATGAGGTGAAAGATTCCGGACATGCAACCGACGGATTTCTC
 
. : . : . : . : . : . :
JMSF022B05+ TCGACGGCGATTTTCCGGCGGCGGTGTCTGCCGGCGGGAGGAGGAGAGTAGAGAATCTTG
JMSF004B05+ TCGACGGCGATTTTCCGGCGGCGGTGTCTGCCGGCGGGAGGAGGAGAGTAGAGAATCTTG
                      ____________________________________________________________
consensus TCGACGGCGATTTTCCGGCGGCGGTGTCTGCCGGCGGGAGGAGGAGAGTAGAGAATCTTG
 
. : . : . : . : . : . :
JMSF022B05+ TCGGTTCAGCATTTTGGTTGGG
JMSF004B05+ TCGGTTCAGCATTTTGGTTGGGTGAAGCGAGTAGCGGACACTGGGAGAGAATAAAAGGCC
                      ____________________________________________________________
consensus TCGGTTCAGCATTTTGGTTGGGTGAAGCGAGTAGCGGACACTGGGAGAGAATAAAAGGCC