Previous Contig 004576:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I06Sequence576004576 (5)gb:AC149287_17448883e-45Solanum demissum chromosome 5 clone PGEC568D21 map MAP_LOC, complete sequence.728020705gb:AC151802_17451101e-62Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMFF017B03Sequence553004576 (5)gb:AC149287_17448886e-40Solanum demissum chromosome 5 clone PGEC568D21 map MAP_LOC, complete sequence.763008986 (4)gb:AC151802_17451101e-75Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMSF004B03Sequence290004576 (5)
JMSF017F05Sequence572004576 (5)gb:AC149287_17448881e-32Solanum demissum chromosome 5 clone PGEC568D21 map MAP_LOC, complete sequence.738008986 (4)gb:AC151802_17451101e-76Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMSF023I20Sequence601004576 (5)gb:AC149287_17448886e-50Solanum demissum chromosome 5 clone PGEC568D21 map MAP_LOC, complete sequence.735008986 (4)gb:AC151802_17451105e-76Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF003I06+ CTCGGTAGTTCATATTTTCTCTCGGGAAAGTC
JMFF017B03+ GAAAGTC
JMSF023I20+ TGAGGAGGGCAATGCCTTTCTCGGTAGTTCATATTTTCTCTCGGGAAAGTC
                      ____________________________________________________________
consensus TGAGGAGGGCAATGCCTTTCTCGGTAGTTCATATTTTCTCTCGGGAAAGTC
 
. : . : . : . : . : . :
JMFF003I06+ ATGGCACGGCTTTGATCTTGGCACGGGGTGTAATCGGTGTAGCGAGCATCACAAGGCTCG
JMFF017B03+ ATGGCACGGCTTTGATCTTGGCACGGGGTGTAATCGGTGTAGCGAGCATCACAAGGCTCG
JMSF023I20+ ATGGCACGGCTTTGATCTTGGCACGGGGTGTAATCGGTGTAGCGAGCATCACAAGGCTCG
JMSF017F05+ TGTAATCGGTGTAGCGAGCATCACAAGGCTCG
                      ____________________________________________________________
consensus ATGGCACGGCTTTGATCTTGGCACGGGGTGTAATCGGTGTAGCGAGCATCACAAGGCTCG
 
. : . : . : . : . : . :
JMFF003I06+ ATTTCTTTCACTTTTGAGTCCGGTTCATCAACACCACCGGGCGGACCACCATGATGGCTC
JMFF017B03+ ATTTCTTTCACTTTTGAGTCCGGTTCATCAACACCACCGGGCGGACCACCATGATGGCTC
JMSF023I20+ ATTTCTTTCACTTTTGAGTCCGGTTCATCAACACCACCGGGCGGACCACCATGATGGCTC
JMSF017F05+ ATTTCTTTCACTTTTGAGTCCGGTTCATCAACACCACCGGGTGGACCACCATGATGGCTC
                      ____________________________________________________________
consensus ATTTCTTTCACTTTTGAGTCCGGTTCATCAACACCACCGGGCGGACCACCATGATGGCTC
 
. : . : . : . : . : . :
JMFF003I06+ TCGAAATTGAGATTTGGCATGACATTGCAGTCATCCGTGGTCTTAGTCACCTCCAAAGCT
JMFF017B03+ TCGAAATTGAGATTTGGCATGACATTGCAGTCATCCGTGGTCTTAGTCACCTCCAAAGCT
JMSF023I20+ TCGAAATTGAGATTTGGCATGACATTGCAGTCATCCGTGGTCTTAGTCACCTCCAAAGCT
JMSF017F05+ TCGAAATTGAGATTTGGCATGACATTGCAGTCATCCGTGGTCTTAGTCACCTCCAAAGCT
                      ____________________________________________________________
consensus TCGAAATTGAGATTTGGCATGACATTGCAGTCATCCGTGGTCTTAGTCACCTCCAAAGCT
 
. : . : . : . : . : . :
JMFF003I06+ ATGCTGTCTCCCTTCCCGAACCCACTCCTTTGCCATGCTCCCAGTAAATAGAAGAAACAA
JMFF017B03+ ATGCTGTCTCCCTTCCCGAACCCACTCCTTTGCCATGCTCCCAGTAAATAGAAGAAACAA
JMSF023I20+ ATGCTGTCTCCCTTCCCGAACCCACTCCTTTGCCATGCTCCCAGTAAATAGAAGAAACAA
JMSF017F05+ ATGCTGTCTCCCTTCCCGAACCCACTCCTTTGCCATGCTCCCAGTAAATAGAAGAAACAA
                      ____________________________________________________________
consensus ATGCTGTCTCCCTTCCCGAACCCACTCCTTTGCCATGCTCCCAGTAAATAGAAGAAACAA
 
. : . : . : . : . : . :
JMFF003I06+ CAAAGACCAGCTATAATAAATATCGACACAGAACTCCTAGTCCGATTGTCCCCTGACACT
JMFF017B03+ CAAAGACCAGCTATAATAAATATCGACACAGAACTCCTAGTCCGATTGTCCCCTGACACT
JMSF023I20+ CAAAGACCAGCTATAATAAATATCGACACAGAACTCCTAGTCCGATTGTCCCCTGACACT
JMSF017F05+ CAAAGACCAGCTATAATAAATATCGACACAGAACTCCTAGTCCGATTGTCCCCTGACACT
                      ____________________________________________________________
consensus CAAAGACCAGCTATAATAAATATCGACACAGAACTCCTAGTCCGATTGTCCCCTGACACT
 
. : . : . : . : . : . :
JMFF003I06+ GGTTTGTTTGCCATTACAACCCAATGGCATAAAAGAAATCAGGAAAACACACTGTTCTTG
JMFF017B03+ GGTTTGTTTGCCATTACAACCCAATGGCATAAAAGAAATCAGGAAAACACACTGTTCTTG
JMSF023I20+ GGTTTGTTTGCCATTACAACCCAATGGCATAAAAGAAATCAGGAAAACACACTGTTCTTG
JMSF017F05+ GGTTTGTTTGCCATTACAACCCAATGGCATAAAAGAAATCAGGAAAACACACTGTTCTTG
JMSF004B03+ CCATTACAACCCAATGGCATAAAAGAAATCAGGAAAACACACTGTTCTTG
                      ____________________________________________________________
consensus GGTTTGTTTGCCATTACAACCCAATGGCATAAAAGAAATCAGGAAAACACACTGTTCTTG
 
. : . : . : . : . : . :
JMFF003I06+ GACGATCTTCAAGCGCCGCTGCTTTTCGCTTTATGGAGGCGTAGTCCTCAATCAAGAATA
JMFF017B03+ GACGATCTTCAAGCGCCGCTGCTTTTCGCTTTATGGAGGCGTAGTCCTCAATCAAGAATA
JMSF023I20+ GACGATCTTCAAGCGCCGCTGCTTTTCGCTTTATGGAGGCGTAGTCCTCAATCAAGAATA
JMSF017F05+ GACGATCTTCAAGCGCCGCTGCTTTTCGCTTTATGGAGGCGTAGTCCTCAATCAAGAATA
JMSF004B03+ GACGATCTTCAAGCGCCGCTGCTTTTCGCTTTATGGAGGCGTAGTCCTCAATCAAGAATA
                      ____________________________________________________________
consensus GACGATCTTCAAGCGCCGCTGCTTTTCGCTTTATGGAGGCGTAGTCCTCAATCAAGAATA
 
. : . : . : . : . : . :
JMFF003I06+ TTGAAACAGAGCCCACCTACAAAGATTTTAGGGGAAGAAAGAAGTAAGAAAATTCACTCG
JMFF017B03+ TTGAAACAGAGCCCACCTACAAAGATTTTAGGGGAAGAAAGAAGTAAGAAAATTCACTCG
JMSF023I20+ TTGAAACAGAGCCCACCTACAAAGATTTTAGGGGAAGAAAGAAGTAAGAAAATTCACTCG
JMSF017F05+ TTGAAACAGAGCCCACCTACAAAGATTTTAGGGGAAGAAAGAAGTAAGAAAATTCACTCG
JMSF004B03+ TTGAAACAGAGCCCACCTACAAAGATTTTAGGGGAAGAAAGAAGTAAGAAAATTCACTCG
                      ____________________________________________________________
consensus TTGAAACAGAGCCCACCTACAAAGATTTTAGGGGAAGAAAGAAGTAAGAAAATTCACTCG
 
. : . : . : . : . : . :
JMFF003I06+ CGAACCTTATCTCTCTCTTGATCTTGAAGATCAAGCTGGGCTGTCTCTCCCTTTAACTC
JMFF017B03+ CGAACCTTATCTCTCTCTTGATCTTGAAGATCAAGCTGGGCTGTCTCTCCCTTTAACTCT
JMSF023I20+ CGAACCTTATCTCTCTCTTGATCTTGAAGATCAAGCTGGGCTGTCTCTCCCTTTAACTCT
JMSF017F05+ CGAACCTTATCTCTCTCTTGATCTTGAAGATCAAGCTGGGCTGTCTCTCCCTTTAACTCT
JMSF004B03+ CGAACCTTATCTCTCTCTTGATCTTGAAGATCAAGCTGGGCTGTCTCTCCCTTTAACTCT
                      ____________________________________________________________
consensus CGAACCTTATCTCTCTCTTGATCTTGAAGATCAAGCTGGGCTGTCTCTCCCTTTAACTCT
 
. : . : . : . : . : . :
JMFF017B03+ CCTTGT
JMSF023I20+ CCTTGT
JMSF017F05+ CCTTGTGGTAGAGGGAGTCCGAGTAGAAAGGATACTAAATAGTGATCAAAAATACGACCA
JMSF004B03+ CCTTGTGGTAGAGGGAGTCCGAGTAGAAAGGATACTAAATAGTGATCAAAAATACGACCA
                      ____________________________________________________________
consensus CCTTGTGGTAGAGGGAGTCCGAGTAGAAAGGATACTAAATAGTGATCAAAAATACGACCA