Previous Contig 004573:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004A13Sequence244004573 (3)
JMSF004M14Sequence383004573 (3)322004652 (6)
JMSF049E10Sequence646004573 (3)723013821 (2)gb:AF360323_17912693e-95Arabidopsis thaliana unknown protein (At3g02720) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049E10+ TCTCCGCCA
                      ____________________________________________________________
consensus TCTCCGCCA
 
. : . : . : . : . : . :
JMSF049E10+ TGCATCAGCTTAAGTACCAACGCCACATTCAGCGCCACCGAGACCGCCAGCAAGTGCTTC
                      ____________________________________________________________
consensus TGCATCAGCTTAAGTACCAACGCCACATTCAGCGCCACCGAGACCGCCAGCAAGTGCTTC
 
. : . : . : . : . : . :
JMSF049E10+ ATCGCCACCGCCGGCAAACACAGCTTCCTGTGCTTCATTTTTCCGGGGAATCTCAAGAAT
                      ____________________________________________________________
consensus ATCGCCACCGCCGGCAAACACAGCTTCCTGTGCTTCATTTTTCCGGGGAATCTCAAGAAT
 
. : . : . : . : . : . :
JMSF049E10+ TTCCGAACGAAAGCGATAGCTAAAAGAAGAAATGTGAGCGTAAAAGAGACGAGCTTGGGT
                      ____________________________________________________________
consensus TTCCGAACGAAAGCGATAGCTAAAAGAAGAAATGTGAGCGTAAAAGAGACGAGCTTGGGT
 
. : . : . : . : . : . :
JMSF049E10+ TGCTTATATATAGGAGGAGAACAAGAAGCGGCGGCAAAGCAAACCAAGCTTTCTGATATC
                      ____________________________________________________________
consensus TGCTTATATATAGGAGGAGAACAAGAAGCGGCGGCAAAGCAAACCAAGCTTTCTGATATC
 
. : . : . : . : . : . :
JMSF049E10+ CCTCTCCTTCGGACCCTCACGGTTACAGTCCATTATTCAAACACTTCTACTCCGTATATG
JMSF004M14+ CCTCACGGTTACAGTCCATTATTCAAACACTTCTACTCCGTATATG
                      ____________________________________________________________
consensus CCTCTCCTTCGGACCCTCACGGTTACAGTCCATTATTCAAACACTTCTACTCCGTATATG
 
. : . : . : . : . : . :
JMSF049E10+ TCTCCTATGTGCATTGGGTTAGCAGAAATAAAAAAGAAAATAAAAAGAAAAATGAAATCT
JMSF004M14+ TCTCCTATGTGCATTGGGTTAGCAGAAATAAAAAAGAAAATAAAAAGAAAAATGAAATCT
                      ____________________________________________________________
consensus TCTCCTATGTGCATTGGGTTAGCAGAAATAAAAAAGAAAATAAAAAGAAAAATGAAATCT
 
. : . : . : . : . : . :
JMSF049E10+ TGGATAGAAAATTGAATGAAATGGCAATTTCGGGGGAGAAATCTGCTCAACTTCAAGGGA
JMSF004M14+ TGGATAGAAAATTGAATGAAATGGCAATTTCGGGGGAGAAATCTGCTCAACTTCAAGGGA
JMSF004A13+ GGGA
                      ____________________________________________________________
consensus TGGATAGAAAATTGAATGAAATGGCAATTTCGGGGGAGAAATCTGCTCAACTTCAAGGGA
 
. : . : . : . : . : . :
JMSF049E10+ TTATAAAGTATAGTAAGAACTTGTTCTTCTCCTCCCAGAAATTTGCAGTTTTCCAATGCA
JMSF004M14+ TTATAAAGTATAGTAAGAACTTGTTCTTCTCCTCCCAGAAATTTGCAGTTTTCCAATGCA
JMSF004A13+ TTATAAAGTATAGTAAGAACTTGTTCTTCTCCTCCCAGAAATTTGCAGTTTTCCAATGCA
                      ____________________________________________________________
consensus TTATAAAGTATAGTAAGAACTTGTTCTTCTCCTCCCAGAAATTTGCAGTTTTCCAATGCA
 
. : . : . : . : . : . :
JMSF049E10+ AAATCTTGGAGAACTTGTATTAGATTCTTCCCCCTAACTTTTATTAGATAGTACTACGAA
JMSF004M14+ AAATCTTGGAGAACTTGTATTAGATTCTTCCCCCTAACTTTTATTAGATAGTACTACGAA
JMSF004A13+ AAATCTTGGAGAACTTGTATTAGATTCTTCCCCCTAACTTTTATTAGATAGTACTACGAA
                      ____________________________________________________________
consensus AAATCTTGGAGAACTTGTATTAGATTCTTCCCCCTAACTTTTATTAGATAGTACTACGAA
 
. : . : . : . : . : . :
JMSF049E10+ AACTGGTTTCAATGTTTTGAATGGCATACATATAAATGAGAGTTTATATGGAACCATACG
JMSF004M14+ AACTGGTTTCAATGTTTTGAATGGCATACATATAAATGAGAGTTTATATGGAACCATACG
JMSF004A13+ AACTGGTTTCAATGTTTTGAATGGCATACATATAAATGAGAGTTTATATGGAACCATACG
                      ____________________________________________________________
consensus AACTGGTTTCAATGTTTTGAATGGCATACATATAAATGAGAGTTTATATGGAACCATACG
 
. : . : . : . : . : . :
JMSF049E10+ GAGACTAGAGAGAGAGGGGTTTGGTTTCGCTTCGCT
JMSF004M14+ GAGACTAGAGAGAGAGGGGTTTGGTTTCGCTTCGCT
JMSF004A13+ GAGACTAGAGAGAGAGGGGTTTGGTTTCGCTTCGCTGGTTCTGGGAAAGAAAAGCTGACC
                      ____________________________________________________________
consensus GAGACTAGAGAGAGAGGGGTTTGGTTTCGCTTCGCTGGTTCTGGGAAAGAAAAGCTGACC