Previous Contig 004572:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS019B04Sequence641004572 (6)gb:AB013448_15122050.001Oryza sativa gene for Pib, complete cds.>gb:AB013449_1512206 Oryza sativa mRNA f
JMFS024E06Sequence623004572 (6)gb:AB013448_15122050.001Oryza sativa gene for Pib, complete cds.>gb:AB013449_1512206 Oryza sativa mRNA f
JMFS026F01Sequence298004572 (6)
JMFS061G07Sequence588004572 (6)gb:AB013448_15122050.001Oryza sativa gene for Pib, complete cds.>gb:AB013449_1512206 Oryza sativa mRNA f
JMFS126B09Sequence626004572 (6)gb:AB013448_15122050.001Oryza sativa gene for Pib, complete cds.>gb:AB013449_1512206 Oryza sativa mRNA f
JMSF004A10Sequence192004572 (6)358003173 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS126B09+ CCAAATCGTGATCAACTTCACTTGACCAC
JMFS024E06+ TTCACTTGACCAC
JMFS061G07+ TGACCAC
JMFS019B04+ AGTTCCCCAAATCGTGATCACNTTCACTTGACCAC
                      ____________________________________________________________
consensus AGTTCCCCAAATCGTGATCACCTTCACTTGACCAC
 
. : . : . : . : . : . :
JMFS126B09+ TACGCTTCTCAATCAGTTGTGCTATCCGGTCGACTTCCATGTCGATCCCCACTGCTTCTA
JMFS024E06+ TACGCTTCTCAATCAGTTGTGCTATCCGGTCGACTTCCATGTCGATCCCCACTGCTTCTA
JMFS061G07+ TACGCTTCTCAATCAGTTGTGCTATCCGGTCGACTTCCATGTCGATCCCCACTGCTTCTA
JMFS019B04+ TACGCTTCTCAATCAGTTGTGCTATCCGGTCGACTTCCATGTCGATCCCCACTGCTTCTA
                      ____________________________________________________________
consensus TACGCTTCTCAATCAGTTGTGCTATCCGGTCGACTTCCATGTCGATCCCCACTGCTTCTA
 
. : . : . : . : . : . :
JMFS126B09+ TCCCCTCCATATATCCACTCCCACTTCCTACTAACTCATTGCTGCTGCTGCTGCTGCTTC
JMFS024E06+ TCCCCTCCATATATCCACTCCCACTTCCTACTAACTCATTGCTGCTGCTGCTGCTGCTTC
JMFS061G07+ TCCCCTCCATATATCCACTCCCACTTCCTACTAACTCATTGCTGCTGCTGCTGCTGCTTC
JMFS019B04+ TCCCCTCCATATATCCACTCCCACTTCCTACTAACTCATTGCTGCTGCTGCTGCTGCTTC
                      ____________________________________________________________
consensus TCCCCTCCATATATCCACTCCCACTTCCTACTAACTCATTGCTGCTGCTGCTGCTGCTTC
 
. : . : . : . : . : . :
JMFS126B09+ CTTCATTTGTCTTAACTTCTATTTTGTACTTTGACTTCTCTTCTTCTAGAAGAAGCAGCT
JMFS024E06+ CTTCATTTGTCTTAACTTCTATTTTGTACTTTGACTTCTCTTCTTCTAGAAGAAGCAGCT
JMFS061G07+ CTTCATTTGTCTTAACTTCTATTTTGTACTTTGACTTCTCTTCTTCTAGAAGAAGCAGCT
JMFS026F01+ TCATTTGTCTGAACTTCTATTTTGTACTTTGACTTCTCTTCTTCTAGAAGAAGCAGCT
JMFS019B04+ CTTCATTTGTCTTAACTTCTATTTTGTACTTTGACTTCTCTTCTTCTAGAAGAAGCAGCT
                      ____________________________________________________________
consensus CTTCATTTGTCTTAACTTCTATTTTGTACTTTGACTTCTCTTCTTCTAGAAGAAGCAGCT
 
. : . : . : . : . : . :
JMFS126B09+ TCTCATCCATCTCTTTTAGCTGCTGATGGAAGCGATACTGGATCATCACCCTCTTGGCAA
JMFS024E06+ TCTCATCCATCTCTTTTAGCTGCTGATGGAAGCGATACTGGATCATCACCCTCTTGGCAA
JMFS061G07+ TCTCATCCATCTCTTTTAGCTGCTGATGGAAGCGATACTGGATCATCACCCTCTTGGCAA
JMFS026F01+ TCTCATCCATCTCTTTTAGCTGCTGATGGAAGCGATACTGGATCATCACCCTCTTGGCAA
JMFS019B04+ TCTCATCCATCTCTTTTAGCTGCTGATGGAAGCGATACTGGATCATCACCCTCTTGGCAA
                      ____________________________________________________________
consensus TCTCATCCATCTCTTTTAGCTGCTGATGGAAGCGATACTGGATCATCACCCTCTTGGCAA
 
. : . : . : . : . : . :
JMFS126B09+ AGCTCTGAATAGTGGCGATGAGGGACTTGGGTTGACAGAAATTGCAGGGTGGAGTATTGA
JMFS024E06+ AGCTCTGAATAGTGGCGATGAGGGACTTGGGTTGACAGAAATTGCAGGGTGGAGTATTGA
JMFS061G07+ AGCTCTGAATAGTGGCGATGAGGGACTTGGGTTGACAGAAATTGCAGGGTGGAGTATTGA
JMFS026F01+ AGCTCTGAATAGTGGCGATGAGGGACTTGGGTTGACAGAAATTGCAGGGTGGAGTATTGA
JMFS019B04+ AGCTCTGAATAGTGGCGATGAGGGACTTGGGTTGACAGAAATTGCAGGGTGGAGTATTGA
                      ____________________________________________________________
consensus AGCTCTGAATAGTGGCGATGAGGGACTTGGGTTGACAGAAATTGCAGGGTGGAGTATTGA
 
. : . : . : . : . : . :
JMFS126B09+ GCTCAAGGAGCTTCATATCCACCATGAACTCCTCAACCAAGTCCTCGAGTTCAAGTGAGG
JMFS024E06+ GCTCAAGGAGCTTCATATCCACCATGAACTCCTCAACCAAGTCCTCGAGTTCAAGTGAGG
JMFS061G07+ GCTCAAGGAGCTTCATATCCACCATGAACTCCTCAACCAAGTCCTCGAGTTCAAGTGAGG
JMFS026F01+ GCTCAAGGAGCTTCATATCCACCATGAACTCCTCAACCAAGTCCTCGAGTTCAAGTGAGG
JMFS019B04+ GCTCAAGGAGCTTCATATCCACCATGAACTCCTCAACCAAGTCCTCGAGTTCAAGTGAGG
                      ____________________________________________________________
consensus GCTCAAGGAGCTTCATATCCACCATGAACTCCTCAACCAAGTCCTCGAGTTCAAGTGAGG
 
. : . : . : . : . : . :
JMFS126B09+ TCTCCCTCAACTGATTCACCCAATTCTCTGCTATCTTGGTTTCCTGTTTCCCCCAACCCA
JMFS024E06+ TCTCCCTCAACTGATTCACCCAATTCTCTGCTATCTTGGTTTCCTGTTTCCCCCAACCCA
JMFS061G07+ TCTCCCTCAACTGATTCACCCAATTCTCTGCTATCTTGGTTTCCTGTTTCCCCCAACCCA
JMFS026F01+ TCTCCCTCAACTGATTCACCCAATTCTCTGCTATCTTGGTTTCCTGTTTCCCCCAACCCA
JMFS019B04+ TCTCCCTCAACTGATTCACCCAATTCTCTGCTATCTTGGTTTCCTGTTTCCCCCAACCCA
JMSF004A10+ TCCCCCAACCCA
                      ____________________________________________________________
consensus TCTCCCTCAACTGATTCACCCAATTCTCTGCTATCTTGGTTTCCTGTTTCCCCCAACCCA
 
. : . : . : . : . : . :
JMFS126B09+ AATGCTCAACATAGCCTTTCATATTTTCTAGCCGAGTTGTGATTTTTTCTGTCTCAGCTT
JMFS024E06+ AATGCTCAACATAGCCTTTCATATTTTCTAGCCGAGTTGTGATTTTTTCTGTCTCAGCTT
JMFS061G07+ AATGCTCAACATAGCCTTTCATATTTTCTAGCCGAGTTGTGATTTTTTCTGTCTCAGCTT
JMFS019B04+ AATGCTCAACATAGCCTTTCATATTTTCTAGCCGAGTTGTGATTTTTTCTGTCTCAGCTT
JMSF004A10+ AATGCTCAACATAGCCTTTCATATTTTCTAGCCGAGTTGTGATTTTTTCTGTCTCAGCTT
                      ____________________________________________________________
consensus AATGCTCAACATAGCCTTTCATATTTTCTAGCCGAGTTGTGATTTTTTCTGTCTCAGCTT
 
. : . : . : . : . : . :
JMFS126B09+ TGATTCTCCACTGGAATATAAATTCTTGGTAAGCTGGTTCCTTCAGCTTTTCAACCAGAG
JMFS024E06+ TGATTCTCCACTGGAATATAAATTCTTGGTAAGCTGGTTCCTTCAGCTTTTCAACCAGAG
JMFS061G07+ TGATTCTCCACTGGAATATAAATTCTTGGTAAGCTGGTTCCTTCAGCTTTTCAACCAGAG
JMFS019B04+ TGATTCTCCACTGGAATATAAATTCTTGGTAAGCTGGTTCCTTCAGCTTTTCAACCAGAG
JMSF004A10+ TGATTCTCCACTGGAATATAAATTCTTGGTAAGCTGGTTCCTTCAGCTTTTCAACCAGAG
                      ____________________________________________________________
consensus TGATTCTCCACTGGAATATAAATTCTTGGTAAGCTGGTTCCTTCAGCTTTTCAACCAGAG
 
. : . : . : . : . : . :
JMFS126B09+ CATTAACTACAGTAGAAGCCATGGTTATTACAGAATAAGAGAGAGTGTCT
JMFS024E06+ CATTAACTACAGTAGAAGCCATGGTTATTACAGAATAAGAGAGAGTGTCT
JMFS061G07+ CATTAACTACAGTAGAAGCCATGGTTATTACAGAATAAGAG
JMFS019B04+ CATTAACTACAGTAGAAGCCATGGTTATTACAGAATAAGAGAGAGTGTCT
JMSF004A10+ CATTAACTACAGTAGAAGCCATGGTTATTACAGAATAAGAGAGAGTGTCTTAAAGCAGCC
                      ____________________________________________________________
consensus CATTAACTACAGTAGAAGCCATGGTTATTACAGAATAAGAGAGAGTGTCTTAAAGCAGCC