Previous Contig 004571:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004A08Sequence223004571 (3)
JMSF005A08Sequence244004571 (3)334008846 (6)gb:STU318068_17230604e-18Solanum tuberosum mRNA for subunit A of ferredoxin-thioredoxin-reductase (ftrapo
JMSF005B05Sequence288004571 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF005B05+ CGGCGTCGCAGGCAGACAAGAACTGGTCCATGTTAGCATGCAGTTCGT
JMSF005A08+ TCGT
                      ____________________________________________________________
consensus CGGCGTCGCAGGCAGACAAGAACTGGTCCATGTTAGCATGCAGTTCGT
 
. : . : . : . : . : . :
JMSF005B05+ CGATGTTTCTGGAGGTTCTCCTCAGTGCATCCATCGCCGCCTCCGGAATCACTTGCCGGC
JMSF005A08+ CGATGTTTCTGGAGGTTCTCCTCAGTGCATCCATCGCCGCCTCCGGAATCACTTGCCGGC
JMSF004A08+ CTCCTCAGTGCATCCATCGCCGCCTCCGGAATCACTTGCCGGC
                      ____________________________________________________________
consensus CGATGTTTCTGGAGGTTCTCCTCAGTGCATCCATCGCCGCCTCCGGAATCACTTGCCGGC
 
. : . : . : . : . : . :
JMSF005B05+ TGCTGCCGCCGCCGCCTCTCTCCTCCGCAACTCCTTGTCCTTCCATTCCTTCGGGGATTC
JMSF005A08+ TGCTGCCGCCGCCGCCTCTCTCCTCCGCAACTCCTTGTCCTTCCATTCCTTCGGGGATTC
JMSF004A08+ TGCTGCCGCCGCCGCCTCTCTCCTCCGCAACTCCTTGTCCTTCCATTCCTTCGGGGATTC
                      ____________________________________________________________
consensus TGCTGCCGCCGCCGCCTCTCTCCTCCGCAACTCCTTGTCCTTCCATTCCTTCGGGGATTC
 
. : . : . : . : . : . :
JMSF005B05+ TTTACCTCTCCTTAACCCGATTAGAGTGCACTCTGGCTGTTTGCAAAATTTACAGTAATG
JMSF005A08+ TTTACCTCTCCTTAACCCGATTAGAGTGCACTCTGGCTGTTTGCAAAATTTACAGTAATG
JMSF004A08+ TTTACCTCTCCTTAACCCGATTAGAGTGCACTCTGGCTGTTTGCAAAATTTACAGTAATG
                      ____________________________________________________________
consensus TTTACCTCTCCTTAACCCGATTAGAGTGCACTCTGGCTGTTTGCAAAATTTACAGTAATG
 
. : . : . : . : . : . :
JMSF005B05+ AAATCGAATGAAGGTTTTAGGGCTTTCCGATAGGGACTACGTTGTCTACTGACGAAAGTC
JMSF005A08+ AAATCGAATGAAGGTTTTAGGGCTTTCCGATAGGGACTACGTTGTCTACTGACGAAAGTC
JMSF004A08+ AAATCGAATGAAGGTTTTAGGGCTTTCCGATAGGGACTACGTTGTCTACTGACGAAAGTC
                      ____________________________________________________________
consensus AAATCGAATGAAGGTTTTAGGGCTTTCCGATAGGGACTACGTTGTCTACTGACGAAAGTC