Previous Contig 004569:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004A01Sequence275004569 (2)
JMSF051B20Sequence663004569 (2)pir|H86414|H864144e-07F28N24.8 protein - Arabidopsis thaliana>gb:AE005172_891776 Arabidopsis thaliana 717024452

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051B20+ CG
                      ____________________________________________________________
consensus CG
 
. : . : . : . : . : . :
JMSF051B20+ AGTACATCAGGATTAGTGCATTCCCTCGAGTCCCGTCCTTCCACATCAAATTCCCCTTTC
                      ____________________________________________________________
consensus AGTACATCAGGATTAGTGCATTCCCTCGAGTCCCGTCCTTCCACATCAAATTCCCCTTTC
 
. : . : . : . : . : . :
JMSF051B20+ CCGAGCATACTCTCCACCAAGCTATCCATTAAGGCAGCGTGGTTTTTCAGTGCAAGGGGT
                      ____________________________________________________________
consensus CCGAGCATACTCTCCACCAAGCTATCCATTAAGGCAGCGTGGTTTTTCAGTGCAAGGGGT
 
. : . : . : . : . : . :
JMSF051B20+ TCGGTTTGGAACCTGAAACTATCCTCGTGGCAAGGCCTCTCACAGGAATAAAATCGCCTA
                      ____________________________________________________________
consensus TCGGTTTGGAACCTGAAACTATCCTCGTGGCAAGGCCTCTCACAGGAATAAAATCGCCTA
 
. : . : . : . : . : . :
JMSF051B20+ GAATCTGGCTTCCTTCCCGGAGGGAGTCTTGGCATAGTTGAAGGATCCTCACACGGGTAG
                      ____________________________________________________________
consensus GAATCTGGCTTCCTTCCCGGAGGGAGTCTTGGCATAGTTGAAGGATCCTCACACGGGTAG
 
. : . : . : . : . : . :
JMSF051B20+ ACTTTGCCTCCATTTTCTCCTCTCCGCTTCCCAGGAGCTTGTTCCCAACAAAACGGAACC
                      ____________________________________________________________
consensus ACTTTGCCTCCATTTTCTCCTCTCCGCTTCCCAGGAGCTTGTTCCCAACAAAACGGAACC
 
. : . : . : . : . : . :
JMSF051B20+ GCAACTGGTTTCGTAACTTCACTCAACTCACAATCGGATTTCGGGACACACAGAGGTTGT
                      ____________________________________________________________
consensus GCAACTGGTTTCGTAACTTCACTCAACTCACAATCGGATTTCGGGACACACAGAGGTTGT
 
. : . : . : . : . : . :
JMSF051B20+ CGTTGTTGTTGTCTATTAGGCTGTGGATTCTCGACATTCTTCCTATTTACACCCTCCAAG
                      ____________________________________________________________
consensus CGTTGTTGTTGTCTATTAGGCTGTGGATTCTCGACATTCTTCCTATTTACACCCTCCAAG
 
. : . : . : . : . : . :
JMSF051B20+ TGACGAACATTGGAATTGATTCTCCTCACTGATATAATTGGCACACTAAGATTAAGCTTT
JMSF004A01+ TCACTGATATAATTGGCACACTAAGANTAAGCTTT
                      ____________________________________________________________
consensus TGACGAACATTGGAATTGATTCTCCTCACTGATATAATTGGCACACTAAGATTAAGCTTT
 
. : . : . : . : . : . :
JMSF051B20+ GTTTTCTCCATTACAACACACTCTTTCTATGGCAATGCCCTCCCCTAAGATTCAACCCTG
JMSF004A01+ GTTTTCTCCATTACAACACACTCTTTCTATGGCAATGCCCTCCCCTAAGATTCAACCCTG
                      ____________________________________________________________
consensus GTTTTCTCCATTACAACACACTCTTTCTATGGCAATGCCCTCCCCTAAGATTCAACCCTG
 
. : . : . : . : . : . :
JMSF051B20+ GCAACTCAAAATAGCACACACTTTTTGTCTTGTTGGATCATGGACCACTTA
JMSF004A01+ GCAACTCAAAATAGCACACACTTTTTGTCTTGTTGGATCATGGACCACTTACTGTGAGAG
                      ____________________________________________________________
consensus GCAACTCAAAATAGCACACACTTTTTGTCTTGTTGGATCATGGACCACTTACTGTGAGAG
 
. : . : . : . : . : . :
JMSF004A01+ GGGAGAGTGAGAGTGTGGGACTTTGGGTGCGCGAGTGTTGGCTTGATTGAATCCGAGATA
                      ____________________________________________________________
consensus GGGAGAGTGAGAGTGTGGGACTTTGGGTGCGCGAGTGTTGGCTTGATTGAATCCGAGATA
 
. : . : . : . : . : . :
JMSF004A01+ GAAGGGGAAAAAGTTGGTAAATTGGAGAGAGAGAGAGAGAGAGAGCAAGGAAAAGTGTTC
                      ____________________________________________________________
consensus GAAGGGGAAAAAGTTGGTAAATTGGAGAGAGAGAGAGAGAGAGAGCAAGGAAAAGTGTTC