Previous Contig 004566:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003P05Sequence296004566 (2)184011291 (2)
JMSF038B18Sequence669004566 (2)gb:AY093173_15751273e-46Arabidopsis thaliana putative protein (At3g47700) mRNA, complete cds.211011291 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038B18+ CCAACTCATCTACA
                      ____________________________________________________________
consensus CCAACTCATCTACA
 
. : . : . : . : . : . :
JMSF038B18+ TGGTCTAGTCCCATCTCCAAAAAGAACACATCCTCACACCATTCCTTTAGAACTGTTGCA
                      ____________________________________________________________
consensus TGGTCTAGTCCCATCTCCAAAAAGAACACATCCTCACACCATTCCTTTAGAACTGTTGCA
 
. : . : . : . : . : . :
JMSF038B18+ AAATAGCGAGACGCGTTGATGCACCTAACTACTTTTGTCAAAGCATCATCATCTGTTAGT
                      ____________________________________________________________
consensus AAATAGCGAGACGCGTTGATGCACCTAACTACTTTTGTCAAAGCATCATCATCTGTTAGT
 
. : . : . : . : . : . :
JMSF038B18+ GCTGTTAGACCTTCAGCGTCTTGGGACCTGAGAAGTATGCAATCAAAAAATTTCTTTACT
                      ____________________________________________________________
consensus GCTGTTAGACCTTCAGCGTCTTGGGACCTGAGAAGTATGCAATCAAAAAATTTCTTTACT
 
. : . : . : . : . : . :
JMSF038B18+ AGTGGTGCTCCTATCAATCTCAAAAACTTTGATCTCAATGAAACAGTTGGCAGTGATCGA
                      ____________________________________________________________
consensus AGTGGTGCTCCTATCAATCTCAAAAACTTTGATCTCAATGAAACAGTTGGCAGTGATCGA
 
. : . : . : . : . : . :
JMSF038B18+ CAACGATCAATGACTGCAGATAAACGCCGAAGAAAGGCACTGGCAATTGCAGGAGACTTG
                      ____________________________________________________________
consensus CAACGATCAATGACTGCAGATAAACGCCGAAGAAAGGCACTGGCAATTGCAGGAGACTTG
 
. : . : . : . : . : . :
JMSF038B18+ GTGTCCCCTTGCCCTGATTGAAGGGCAGATCCTTGAACATCACTCGACCAATTTCTTTCA
                      ____________________________________________________________
consensus GTGTCCCCTTGCCCTGATTGAAGGGCAGATCCTTGAACATCACTCGACCAATTTCTTTCA
 
. : . : . : . : . : . :
JMSF038B18+ TCCACTATATCAGGTTTCAATTTATCAAGTGCATCATCAAGTTCAATTTCAGCCCATAAG
                      ____________________________________________________________
consensus TCCACTATATCAGGTTTCAATTTATCAAGTGCATCATCAAGTTCAATTTCAGCCCATAAG
 
. : . : . : . : . : . :
JMSF038B18+ TCAAGCCAATCAGGTCTGTCACCAAATACAGAAAGTGAAGAAATCTTCCGAAGTCCATCT
                      ____________________________________________________________
consensus TCAAGCCAATCAGGTCTGTCACCAAATACAGAAAGTGAAGAAATCTTCCGAAGTCCATCT
 
. : . : . : . : . : . :
JMSF038B18+ TCATGCAATGAAAGTGAGATTCCTGATTGTGAATCACTGAATCCATGAGTGAAAGAGTCT
JMSF003P05+ TGTGAATCACTGAATCCATGAGTGAAAGAGTCT
                      ____________________________________________________________
consensus TCATGCAATGAAAGTGAGATTCCTGATTGTGAATCACTGAATCCATGAGTGAAAGAGTCT
 
. : . : . : . : . : . :
JMSF038B18+ GGTCATCTGGTTTATAGTGATTTGGTTTATGGGTTTAGGGTTTGGGAACTGTAGGGGAAA
JMSF003P05+ GGTCATCTGGTTTATAGTGATTTGGTTTATGGGTTTAGGGTTTGGGAACTGTAGGGGAAA
                      ____________________________________________________________
consensus GGTCATCTGGTTTATAGTGATTTGGTTTATGGGTTTAGGGTTTGGGAACTGTAGGGGAAA
 
. : . : . : . : . : . :
JMSF038B18+ AGGGAATCGAAAGCTATGGCAGAGACGAGCTTCAATCTGGTTCGTTACAACAAT
JMSF003P05+ AGGGAATCGAAAGCTATGGCAGAGACGAGCTTCAATCTGGTTCGTTACAACAATAGCACC
                      ____________________________________________________________
consensus AGGGAATCGAAAGCTATGGCAGAGACGAGCTTCAATCTGGTTCGTTACAACAATAGCACC