Previous Contig 004560:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003F12Sequence537004560 (39)pir|T07062|T070622e-17probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t634003898 (8)gb:CRLOX_16734281e-74Cuscuta reflexa lipoxygenase (lox) mRNA, partial cds.
JMFF016I19Sequence198004560 (39)
JMFS004H05Sequence509004560 (39)pir|T07062|T070623e-15probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS005D01Sequence556004560 (39)pir|T07062|T070622e-23probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS018C03Sequence633004560 (39)pir|T07062|T070626e-38probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS020E12Sequence618004560 (39)pir|T07062|T070622e-27probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS021F04Sequence613004560 (39)pir|T07062|T070621e-33probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS023B09Sequence605004560 (39)pir|T07062|T070628e-35probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS029B08Sequence621004560 (39)pir|T07062|T070624e-23probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS034C06Sequence616004560 (39)pir|T07062|T070624e-33probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS042B09Sequence636004560 (39)pir|T07062|T070623e-31probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS051B05Sequence617004560 (39)pir|T07062|T070624e-50probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS052F06Sequence634004560 (39)pir|T07062|T070626e-38probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS067B10Sequence613004560 (39)pir|T07062|T070624e-33probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS069H06Sequence609004560 (39)pir|T07062|T070628e-51probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS072F09Sequence610004560 (39)pir|T07062|T070624e-26probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS073B12Sequence619004560 (39)pir|T07062|T070621e-25probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS074B08Sequence616004560 (39)pir|T07062|T070624e-33probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS076E02Sequence622004560 (39)pir|T07062|T070622e-33probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS099F03Sequence615004560 (39)pir|T07062|T070625e-24probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS104C08Sequence613004560 (39)pir|T07062|T070624e-31probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS111B05Sequence627004560 (39)pir|T07062|T070628e-28probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS124F07Sequence554004560 (39)pir|T07062|T070622e-23probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS124H02Sequence573004560 (39)pir|T07062|T070622e-22probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS125G12Sequence547004560 (39)pir|T07062|T070622e-21probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS131B10Sequence641004560 (39)pir|T07062|T070623e-39probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS131D12Sequence626004560 (39)pir|T07062|T070622e-24probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS133C06Sequence620004560 (39)pir|T07062|T070622e-33probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS134H04Sequence617004560 (39)pir|T07062|T070621e-25probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS142A09Sequence626004560 (39)pir|T07062|T070622e-30probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS142F03Sequence626004560 (39)pir|T07062|T070627e-32probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS142G01Sequence602004560 (39)pir|T07062|T070622e-30probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS143G03Sequence626004560 (39)pir|T07062|T070622e-25probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS151H05Sequence626004560 (39)pir|T07062|T070626e-33probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS158A03Sequence473004560 (39)pir|T07062|T070621e-12probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS164G03Sequence606004560 (39)pir|T07062|T070622e-30probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMFS165C08Sequence608004560 (39)pir|T07062|T070626e-38probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t
JMSF003N23Sequence385004560 (39)751003898 (8)gb:CRLOX_1673428e-101Cuscuta reflexa lipoxygenase (lox) mRNA, partial cds.
JMSF027G22Sequence659004560 (39)pir|T07062|T070621e-36probable lipoxygenase (EC 1.13.11.12) (clone H1) - potato>gb:ST13LH1_1722664 S.t792003898 (8)gb:CRLOX_1673428e-109Cuscuta reflexa lipoxygenase (lox) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS069H06+ TCAGTCCGCTTGGAG
JMFS051B05+ CAGTCCGCTTGGAG
                      ____________________________________________________________
consensus TCAGTCCGCTTGGAG
 
. : . : . : . : . : . :
JMFS069H06+ TTTGAGACGGTAAATATGACTTGTTAGTGAAAAGGATTCTTTTCTCAGGATTGTCGAACT
JMFS051B05+ TNTGAGACGGTAAATATGACTTGTTAGTGAAAAGGATTCTTTTCTCAGGATTGTCGAACT
JMFS165C08+ CGAACT
JMFS052F06+ CGAACT
JMFS018C03+ GAACT
JMFS042B09+ GTCGAACT
JMFS131B10+ GTCGAACT
                      ____________________________________________________________
consensus TTTGAGACGGTAAATATGACTTGTTAGTGAAAAGGATTCTTTTCTCAGGATTGTCGAACT
 
. : . : . : . : . : . :
JMFS069H06+ TGGAATGCACCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS051B05+ TGGAATGCACCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS165C08+ TGGAATGCACCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS052F06+ TGGAATGCACCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS020E12+ CCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS072F09+ AGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS023B09+ CCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS124H02+ GGAGTCCGTCAATGA
JMFS018C03+ TGGAATGCACCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS042B09+ TGGAATGCACCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS131B10+ TGGAATGCACCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS151H05+ TCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS104C08+ ACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS142G01+ GTCCGTCAATGA
JMFS142F03+ CGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS111B05+ GCACCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS143G03+ ACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS099F03+ TAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS131D12+ ATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS133C06+ GGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS076E02+ CAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS164G03+ CATGCGATGTTAACGGTGCCG-TAGGGAGTCCGTCAATGA
JMFS142A09+ CACATGCGATGTTAACGGTGCCG-TAGGGAGTCCGTCAATGA
JMFS074B08+ GAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS034C06+ GAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS134H04+ GAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS073B12+ GAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS021F04+ GGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS067B10+ GAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
JMFS029B08+ GGAATCACATGCGATGTTAACGGTGCCG-TAGGGAGTCCGTCAATGA
JMSF027G22+ GGAATGCACCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
                      ____________________________________________________________
consensus TGGAATGCACCCAGGAATCACATGCGATGTTAACGGTGCCGTTAGGGAGTCCGTCAATGA
 
. : . : . : . : . : . :
JMFS069H06+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS051B05+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS165C08+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS052F06+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS020E12+ CGATCTTTTTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS072F09+ CGATCTTTTTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS023B09+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS124H02+ CGATCTTTNTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS018C03+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS042B09+ CGATCTTTTTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS131B10+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS151H05+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS104C08+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS142G01+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS142F03+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS111B05+ CGATCTTTTTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS143G03+ CGATCTTTTTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS099F03+ CGATCTTTTTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS131D12+ CGATCTTTTTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS133C06+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS076E02+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS164G03+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS142A09+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS074B08+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS034C06+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS134H04+ CGATCTTTTTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS073B12+ CGATCTTTTTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS021F04+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS067B10+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS029B08+ CGATCTTTTTGACAAATATTTCTNTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
JMFS124F07+ CTCATTCTCTATGATAATTGCTCCGACCT
JMFS125G12+ TCTATGATAATTGCTCCGACCT
JMFS005D01+ CTCATTCTCTATGATAATTGCTCCGACCT
JMSF027G22+ CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
                      ____________________________________________________________
consensus CGATCTTTTTGACAAATATTTCTTTGTGGTGCTCATTCTCTATGATAATTGCTCCGACCT
 
. : . : . : . : . : . :
JMFS069H06+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS051B05+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTTACTTCGCCATCCTTTTCGC
JMFS165C08+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS052F06+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS020E12+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS072F09+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS023B09+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS124H02+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS018C03+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS042B09+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS131B10+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS151H05+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS104C08+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS142G01+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS142F03+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS111B05+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS143G03+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS099F03+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS131D12+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS133C06+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS076E02+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS164G03+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS142A09+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS074B08+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS034C06+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS134H04+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS073B12+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS021F04+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS067B10+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS029B08+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS124F07+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS125G12+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS005D01+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS004H05+ ATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMFS158A03+ TAGTTCACTTCGCCATCCTTTTCGC
JMFF003F12+ CCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
JMSF027G22+ CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
                      ____________________________________________________________
consensus CCCCGAAGTTTTCAGGAATTACGAGATCGCACTCGTAGTTCACTTCGCCATCCTTTTCGC
 
. : . : . : . : . : . :
JMFS069H06+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS051B05+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS165C08+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS052F06+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS020E12+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS072F09+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS023B09+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS124H02+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS018C03+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS042B09+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS131B10+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS151H05+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS104C08+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS142G01+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS142F03+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS111B05+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS143G03+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS099F03+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS131D12+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS133C06+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS076E02+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS164G03+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS142A09+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS074B08+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS034C06+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS134H04+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS073B12+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS021F04+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS067B10+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS029B08+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS124F07+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS125G12+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS005D01+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS004H05+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFS158A03+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMFF003F12+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
JMSF027G22+ TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
                      ____________________________________________________________
consensus TCTGCCGATGTGCATAGCCCTGGATAGTTTTCTTCTCTTCCCCCGTCTTATGGTCCAGCT
 
. : . : . : . : . : . :
JMFS069H06+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS051B05+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS165C08+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS052F06+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS020E12+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS072F09+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS023B09+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS124H02+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS018C03+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS042B09+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS131B10+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS151H05+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS104C08+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS142G01+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS142F03+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS111B05+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS143G03+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS099F03+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS131D12+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS133C06+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS076E02+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS164G03+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS142A09+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS074B08+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS034C06+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS134H04+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS073B12+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS021F04+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS067B10+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS029B08+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS124F07+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS125G12+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS005D01+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS004H05+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFS158A03+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMFF003F12+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMSF027G22+ CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
JMSF003N23+ AGCAAGTCATTAATATCATCAAGCG
                      ____________________________________________________________
consensus CAGCAGCCACAATATCCAAAAGGAGAGTTTTCCCCAGCAAGTCATTAATATCATCAAGCG
 
. : . : . : . : . : . :
JMFS069H06+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS051B05+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS165C08+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS052F06+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS020E12+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS072F09+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS023B09+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS124H02+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS018C03+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS042B09+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS131B10+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS151H05+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS104C08+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS142G01+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS142F03+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS111B05+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS143G03+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS099F03+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS131D12+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS133C06+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS076E02+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS164G03+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS142A09+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS074B08+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS034C06+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS134H04+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS073B12+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS021F04+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS067B10+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS029B08+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS124F07+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS125G12+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS005D01+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS004H05+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFS158A03+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMFF003F12+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMSF027G22+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
JMSF003N23+ CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
                      ____________________________________________________________
consensus CTCTCGTGAGGTTCAAGTTGGAGAGAATCCCTCCCACGGTGCTTTTCACCGTCACCACGG
 
. : . : . : . : . : . :
JMFS069H06+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS051B05+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS165C08+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS052F06+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS020E12+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS072F09+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS023B09+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS124H02+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS018C03+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS042B09+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS131B10+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS151H05+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS104C08+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS142G01+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS142F03+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS111B05+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS143G03+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS099F03+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS131D12+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS133C06+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS076E02+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS164G03+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS142A09+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS074B08+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS034C06+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS134H04+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS073B12+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS021F04+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS067B10+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS029B08+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS124F07+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS125G12+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS005D01+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS004H05+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFS158A03+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMFF003F12+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMSF027G22+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
JMSF003N23+ CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
                      ____________________________________________________________
consensus CTTTAACGCTCGTGGATTTCTCAGTAGTAGAGTCGGCGGCCACAGCTTTGATGTTGCATG
 
. : . : . : . : . : . :
JMFS069H06+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS051B05+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS165C08+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS052F06+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS020E12+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS072F09+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS023B09+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS124H02+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS018C03+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS042B09+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS131B10+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS151H05+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS104C08+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS142G01+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS142F03+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS111B05+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS143G03+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS099F03+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS131D12+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS133C06+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS076E02+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS164G03+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS142A09+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS074B08+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS034C06+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS134H04+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS073B12+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS021F04+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS067B10+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS029B08+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS124F07+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS125G12+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS005D01+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS004H05+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFS158A03+ GTCTGTAGCCCACCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMFF016I19+ TCTCAGGCTTTTGCCGCCACCGC
JMFF003F12+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMSF027G22+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
JMSF003N23+ GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
                      ____________________________________________________________
consensus GTCTGTAGCGCAGCAGTGACGACTTTCCGGTGGCTTTTCTCAGGCTTTTGCCGCCACCGC
 
. : . : . : . : . : . :
JMFS069H06+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGC
JMFS051B05+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS165C08+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS052F06+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS020E12+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS072F09+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS023B09+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS124H02+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS018C03+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS042B09+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS131B10+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS151H05+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS104C08+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS142G01+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS142F03+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS111B05+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS143G03+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS099F03+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS131D12+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS133C06+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS076E02+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS164G03+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS142A09+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS074B08+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS034C06+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS134H04+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS073B12+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS021F04+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS067B10+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS029B08+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS124F07+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS125G12+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS005D01+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS004H05+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFS158A03+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFF016I19+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMFF003F12+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMSF027G22+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
JMSF003N23+ CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
                      ____________________________________________________________
consensus CGCCGCCGGAGTTGGGCTTCACGAGCGCCGGGACCATGGCCACCGTGGAGTCGCCGCCGT
 
. : . : . : . : . : . :
JMFS051B05+ AGA
JMFS165C08+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS052F06+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS020E12+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS072F09+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS023B09+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS124H02+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS018C03+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS042B09+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS131B10+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS151H05+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS104C08+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS142G01+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS142F03+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS111B05+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS143G03+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS099F03+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS131D12+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS133C06+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS076E02+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS164G03+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS142A09+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS074B08+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS034C06+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS134H04+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS073B12+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS021F04+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS067B10+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS029B08+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS124F07+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS125G12+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS005D01+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS004H05+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFS158A03+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMFF016I19+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACC
JMFF003F12+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMSF027G22+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
JMSF003N23+ AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
                      ____________________________________________________________
consensus AGACGAACGGCGGCTTGTACCAGGGAATAACTAGGGGTTTTGATGTAGCATGCTGAAACT
 
. : . : . : . : . : . :
JMFS165C08+ GA
JMFS052F06+ GAGGCTTTATCATTATATTATATTTTTG
JMFS020E12+ GAGGCTTTATCATTATATTATATTTTT
JMFS072F09+ GAGGCTTTATCATTATATTATA
JMFS023B09+ GAGGCTTTATCATTA
JMFS124H02+ GAGGCTTTATCATTATAT
JMFS018C03+ GAGGCTTTATCATTATATTATATTTTTG
JMFS042B09+ GAGGCTTTATCATTATATTATATTTTTG
JMFS131B10+ GAGGCTTTATCATTATATTATATTTTTGTA
JMFS151H05+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGT
JMFS104C08+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTT
JMFS142G01+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTTGCAAA
JMFS142F03+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTTGCAAA
JMFS111B05+ GAGGCTTTATCATTATATTATATTTTTGTACAA
JMFS143G03+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTT
JMFS099F03+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTT
JMFS131D12+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTTGC
JMFS133C06+ GAGGCTTTATCATTATATTATATTTTTGTACAA
JMFS076E02+ GAGGCTTTATCATTATATTATATTTTTGTACAA
JMFS164G03+ GAGGCTTTATCATTATATTATATTTTT
JMFS142A09+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTT
JMFS074B08+ GAGGCTTTATCATTATATTATATTTTTGTA
JMFS034C06+ GAGGCTTTATCATTATATTATATTTTTGTA
JMFS134H04+ GAGGCTTTATCATTATATTATATTTTTGTAC
JMFS073B12+ GAGGCTTTATCATTATATTATATTTTTGTACAA
JMFS021F04+ GAGGCTTTATCATTATATTATATTTT
JMFS067B10+ GAGGCTTTATCATTATATTATATTTTT
JMFS029B08+ GAGGCTTTATCATTATATTATATTTTTGTACAATA
JMFS124F07+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTT
JMFS125G12+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTT
JMFS005D01+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTTGC
JMFS004H05+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTTG
JMFS158A03+ GAGGCTTTATCATTATATTATATTTTTG
JMFF016I19+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTTGCAAATGTGT
JMFF003F12+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTTGCAAATGTGT
JMSF027G22+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTTGCAAATGTGT
JMSF003N23+ GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTTGCAAATGTGTGGTTC
                      ____________________________________________________________
consensus GAGGCTTTATCATTATATTATATTTTTGTACAATAATTATAGTTTGCAAATGTGTGGTTC