Previous Contig 004554:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003M22Sequence337004554 (5)735012837 (2)
JMSF003P06Sequence292004554 (5)
JMSF012I03Sequence234004554 (5)752022497
JMSF028C07Sequence167004554 (5)
JMSF032H04Sequence674004554 (5)739012837 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032H04+ TCTTCTTAAG
                      ____________________________________________________________
consensus TCTTCTTAAG
 
. : . : . : . : . : . :
JMSF032H04+ ACAAAGAACTCATCCTACCAAAACCACAAACCATGAGGAAGATCACATCTTCATGCACCA
                      ____________________________________________________________
consensus ACAAAGAACTCATCCTACCAAAACCACAAACCATGAGGAAGATCACATCTTCATGCACCA
 
. : . : . : . : . : . :
JMSF032H04+ TTGGAGCAAAGAGGAAGCATGGTCATCAAAACAAGGTATTTCCCGAAACTAAACACTTAA
                      ____________________________________________________________
consensus TTGGAGCAAAGAGGAAGCATGGTCATCAAAACAAGGTATTTCCCGAAACTAAACACTTAA
 
. : . : . : . : . : . :
JMSF032H04+ CTACATTGATTACAGTTAACTTTATGCATATAATAATTCATATGATAGCTAAACCTAGGC
                      ____________________________________________________________
consensus CTACATTGATTACAGTTAACTTTATGCATATAATAATTCATATGATAGCTAAACCTAGGC
 
. : . : . : . : . : . :
JMSF032H04+ TTTTAGGATTAGAAACAACTTATCTGTAAATCAAATGTATTTCTACGAGTCTGACCACAT
                      ____________________________________________________________
consensus TTTTAGGATTAGAAACAACTTATCTGTAAATCAAATGTATTTCTACGAGTCTGACCACAT
 
. : . : . : . : . : . :
JMSF032H04+ CCTGTGTGCAAAGAACAGTCTCCTCCCAATTAATTAATCTCAAAAAGTATTCCGATTTGA
                      ____________________________________________________________
consensus CCTGTGTGCAAAGAACAGTCTCCTCCCAATTAATTAATCTCAAAAAGTATTCCGATTTGA
 
. : . : . : . : . : . :
JMSF032H04+ GATCAAATCGACGATTGCCTCTTCTACTGATGTTATCGATGTTTTGTTGATAGATCTCGG
                      ____________________________________________________________
consensus GATCAAATCGACGATTGCCTCTTCTACTGATGTTATCGATGTTTTGTTGATAGATCTCGG
 
. : . : . : . : . : . :
JMSF032H04+ TCCACAATCAGTCTACTGATGTTATCGGTGTTTTGTTGATAGATCTCGGTCCACAATCAG
                      ____________________________________________________________
consensus TCCACAATCAGTCTACTGATGTTATCGGTGTTTTGTTGATAGATCTCGGTCCACAATCAG
 
. : . : . : . : . : . :
JMSF032H04+ ACCTAATCGAAACGATTCTCTGTAACCCTAAACTCTGCTTCATTTTGCAATATGAGATGA
                      ____________________________________________________________
consensus ACCTAATCGAAACGATTCTCTGTAACCCTAAACTCTGCTTCATTTTGCAATATGAGATGA
 
. : . : . : . : . : . :
JMSF032H04+ TTGCATGTCGCAGATTTGTGTTCAACACTCTGTAATCAGAAATTAGAAAACATACACTCA
JMSF003P06+ ACTCA
JMSF012I03+ ACTCA
JMSF003M22+ CAGAAATTAGAAAACATACACTCA
                      ____________________________________________________________
consensus TTGCATGTCGCAGATTTGTGTTCAACACTCTGTAATCAGAAATTAGAAAACATACACTCA
 
. : . : . : . : . : . :
JMSF032H04+ GAATTCCAGATTGCCTCTCGGATCTCTAAGCTTTCTATAGAGAGATATAGTGTTTCTTCA
JMSF003P06+ GAATTCCAGATTGCCTCTCGGATCTCTAAGCTTTCTATAGAGAGATATAGTGTTTCTTCA
JMSF012I03+ GAATTCCAGATTGCCTCTCGGATCTCTAAGCTTTCTATAGAGAGATATAGTGTTTCTTCA
JMSF003M22+ GAATTCCAGATTGCCTCTCGGATCTCTAAGCTTTCTATAGAGAGATATAGTGTTTCTTCA
                      ____________________________________________________________
consensus GAATTCCAGATTGCCTCTCGGATCTCTAAGCTTTCTATAGAGAGATATAGTGTTTCTTCA
 
. : . : . : . : . : . :
JMSF032H04+ CAGTGCTATGGTGTAGAATTTGAGAGTGAGAACACAGAGAGTGAGAGATGCTTAAGAATC
JMSF028C07+ GTAGAATNTGNGAGTGAGAACACAGAGAGTGNGAGATGCTTAAGAATC
JMSF003P06+ CANTGCTATGGTGTAGAATTTGAGAGTGAGAACACAGAGAGTGAGAGATGCTTAAGAATC
JMSF012I03+ CANTGCTATGGTGTAGAATTTGAGAGTGAGAACACAGAGAGTGAGAGATGCTTAAGAATC
JMSF003M22+ CANTGCTATGGTGTAGAATTTGAGAGTGAGAACACAGAGAGTGAGAGATGCTTAAGAATC
                      ____________________________________________________________
consensus CAGTGCTATGGTGTAGAATTTGAGAGTGAGAACACAGAGAGTGAGAGATGCTTAAGAATC
 
. : . : . : . : . : . :
JMSF032H04+ ACC
JMSF028C07+ ACCGGTCGAAATNGGAGATCACCGGTGATTCTTAAGGCTGGGATAGCGAGAGAGAGAGAG
JMSF003P06+ ACCGGTCGAAATTGGAGATCACCGGTGATTCTTAAGGCTGGGATAGCGAGAGAGAGAGAG
JMSF012I03+ ACCGGTCGAAATTGGAGATCACCGGTGATTCTTAAGGCTGGGATAGCGAGAGAGAGAGAG
JMSF003M22+ ACCGGTCGAAATTGGAGATCACCGGTGATTCTTAAGGCTGGGATAGCGAGAGAGAGAGAG
                      ____________________________________________________________
consensus ACCGGTCGAAATTGGAGATCACCGGTGATTCTTAAGGCTGGGATAGCGAGAGAGAGAGAG
 
. : . : . : . : . : . :
JMSF028C07+ AGAGAGAGGTAGGTCTCTAATCAGA-CAGNGAGGTCAACAACGCATATTAGGCAACCATC
JMSF003P06+ AGAGAGAGGTAGGTCTCTAATCAGA-CAGTGAGGTCAACAACGCATATTAGGCAACCATC
JMSF012I03+ AGAGAGAGGTAGGTCTCT
JMSF003M22+ AGAGAGAGGTAGGTCTCTAATCAGACCAGTGAGGTCAACAACGCATATTAGGCAACCATC
                      ____________________________________________________________
consensus AGAGAGAGGTAGGTCTCTAATCAGA-CAGTGAGGTCAACAACGCATATTAGGCAACCATC