Previous Contig 004552:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS021C06Sequence610004552 (3)gb:AP004257_18392331e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ13
JMSF003M20Sequence356004552 (3)gb:AP004257_18392339e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ13185022095
JMSF016L01Sequence480004552 (3)gb:AP004257_18392335e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ13737022730pir|G84613|G846131e-38hypothetical protein At2g22530 [imported] - Arabidopsis thaliana>gb:AC006592_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS021C06+ CGTGCATCACCATCT
                      ____________________________________________________________
consensus CGTGCATCACCATCT
 
. : . : . : . : . : . :
JMFS021C06+ TCCAACCAACTCTAAGAAATTGAACTGCATAGCAGAAAAGTTTAAAAAGTTAAATTAAGG
                      ____________________________________________________________
consensus TCCAACCAACTCTAAGAAATTGAACTGCATAGCAGAAAAGTTTAAAAAGTTAAATTAAGG
 
. : . : . : . : . : . :
JMFS021C06+ GGTACAACTAAATCAATTTGTGAGCTAAAATTGACAAAACTATTCCAACACCAATAATGT
                      ____________________________________________________________
consensus GGTACAACTAAATCAATTTGTGAGCTAAAATTGACAAAACTATTCCAACACCAATAATGT
 
. : . : . : . : . : . :
JMFS021C06+ TATCATCCAAGAGGGCTTGTGTGTTGAAATTGAAGGCAACATCCAAAAAACCCCCAATTG
                      ____________________________________________________________
consensus TATCATCCAAGAGGGCTTGTGTGTTGAAATTGAAGGCAACATCCAAAAAACCCCCAATTG
 
. : . : . : . : . : . :
JMFS021C06+ CACCAGAAACCATGGCCTTCAAGCGAGGCATAGTGACAGTTGGAGGTGCAGCCTTCGCAT
JMSF016L01+ CACCAGAAACCATGGCCTTCAAGCGAGGCATAGTGACAGTTGGAGGTGCAGCCTTCGCAT
                      ____________________________________________________________
consensus CACCAGAAACCATGGCCTTCAAGCGAGGCATAGTGACAGTTGGAGGTGCAGCCTTCGCAT
 
. : . : . : . : . : . :
JMFS021C06+ GGTAGCCAACTGCTCTTCCTTGATTCAATAATGACTGAGTATATGGCATAGCCTCCTTAA
JMSF016L01+ GGTAGCCAACTGCTCTTCCTTGATTCAATAATGACTGAGTATATGGCATAGCCTCCTTAA
                      ____________________________________________________________
consensus GGTAGCCAACTGCTCTTCCTTGATTCAATAATGACTGAGTATATGGCATAGCCTCCTTAA
 
. : . : . : . : . : . :
JMFS021C06+ AAGCTTCAGGAGGAGAATGCCCATCTTTTCCAAGCACAAATTCCGCAGGAAGACCGTCAA
JMSF016L01+ AAGCTTCAGGAGGAGAATGCCCATCTTTTCCAAGCACAAATTCCGCAGGAAGACCGTCAA
JMSF003M20+ TTCAGGAGGAGAATGCCCATCTTTTCCAAGCACAAATTCCGCAGGAAGACCGTCAA
                      ____________________________________________________________
consensus AAGCTTCAGGAGGAGAATGCCCATCTTTTCCAAGCACAAATTCCGCAGGAAGACCGTCAA
 
. : . : . : . : . : . :
JMFS021C06+ TTACCATCAGTATCAAACGGTCAAATAAAGGAGGCACCCCAGACAACTCCTGATATAAGG
JMSF016L01+ TTACCATCAGTATCAAACGGTCAAATAAAGGAGGCACCCCAGACAACTCCTGATATAAGG
JMSF003M20+ TTACCATCAGTATCAAACGGTCAAATAAAGGAGGCACCCCAGACAACTCCTGATATAAGG
                      ____________________________________________________________
consensus TTACCATCAGTATCAAACGGTCAAATAAAGGAGGCACCCCAGACAACTCCTGATATAAGG
 
. : . : . : . : . : . :
JMFS021C06+ ATTTGAGCTGATCAGCTGACAAAATGGTTGCATTTTGACCTTCGAATGAATTCGAACCCG
JMSF016L01+ ATTTGAGCTGATCAGCTGACAAAATGGTTGCATTTTGACCTTCGAATGAATTCGAACCCG
JMSF003M20+ ATTTGAGCTGATCAGCTGACAAAATGGTTGCATTTTGACCTTCGAATGAATTCGAACCCG
                      ____________________________________________________________
consensus ATTTGAGCTGATCAGCTGACAAAATGGTTGCATTTTGACCTTCGAATGAATTCGAACCCG
 
. : . : . : . : . : . :
JMFS021C06+ GGGGATAAAAACTCTCCAACCCGCTGACGCCGGAAAGTGTAGGCTTGACGGGAAAGAAGC
JMSF016L01+ GGGGATAAAAACTCTCCAACCCGCTGACGCCGGAAAGTGTAGGCTTGACGGGAAAGAAGC
JMSF003M20+ GGGGATAAAAACTCTCCAACCCGCTGACGCCGGAAAGTGTAGGCTTGACGGGAAAGAAGC
                      ____________________________________________________________
consensus GGGGATAAAAACTCTCCAACCCGCTGACGCCGGAAAGTGTAGGCTTGACGGGAAAGAAGC
 
. : . : . : . : . : . :
JMFS021C06+ CCAAAACGAAGAGAGAGAGACCGATGATTTGTATTACAACTGCTAACACTGCCAA
JMSF016L01+ CCAAAACGAAGAGAGAGAGACCGATGATTTGTATTACAACTGCTAACACTGCCAACAACG
JMSF003M20+ CCAAAACGAAGAGAGAGAGACCGATGATTTGTATTACAACTGCTAACACTGCCAACAACG
                      ____________________________________________________________
consensus CCAAAACGAAGAGAGAGAGACCGATGATTTGTATTACAACTGCTAACACTGCCAACAACG
 
. : . : . : . : . : . :
JMSF016L01+ TTATTTTCGTGCATGTCAATGAAGATGAAGGATTCGCCATTCTTCAGTGCTTCCTACTCC
JMSF003M20+ TTATTTTCGTGCATGTCAATGAAGATGAAGGATTCGCCATTCTTCAGTGCTTCCTACTCC
                      ____________________________________________________________
consensus TTATTTTCGTGCATGTCAATGAAGATGAAGGATTCGCCATTCTTCAGTGCTTCCTACTCC