Previous Contig 004551:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003M18Sequence342004551 (2)gb:AB006703_15099587e-26Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRH10.>gb:AY080755_1568249001008 (19)
JMSF024N21Sequence686004551 (2)gb:AB006703_15099583e-36Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRH10.>gb:AY080755_1568

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024N21+ TGGAGAAATCCAGGCTAGCAAATTTG
                      ____________________________________________________________
consensus TGGAGAAATCCAGGCTAGCAAATTTG
 
. : . : . : . : . : . :
JMSF024N21+ TACCTCCCACAAAGATCAAAGAAAATGGAAAAGCCAATAACTATAACTTCACCGAGGAGC
                      ____________________________________________________________
consensus TACCTCCCACAAAGATCAAAGAAAATGGAAAAGCCAATAACTATAACTTCACCGAGGAGC
 
. : . : . : . : . : . :
JMSF024N21+ ATCTTCAGCAGGTCCCTGAATCTGATAGGATCCACAACGATAACTTTACAGAGCAATCCA
                      ____________________________________________________________
consensus ATCTTCAGCAGGTCCCTGAATCTGATAGGATCCACAACGATAACTTTACAGAGCAATCCA
 
. : . : . : . : . : . :
JMSF024N21+ ATGGTCCACTTCCAAGTAAAATGGACACTGTACAAGACCAATTACATGCTCCTATCGAGG
                      ____________________________________________________________
consensus ATGGTCCACTTCCAAGTAAAATGGACACTGTACAAGACCAATTACATGCTCCTATCGAGG
 
. : . : . : . : . : . :
JMSF024N21+ AACCGGTTTCAGAGACTCAGAAACATACTTATGCTTCTATTGTTGCAAAAAGACAACCTG
                      ____________________________________________________________
consensus AACCGGTTTCAGAGACTCAGAAACATACTTATGCTTCTATTGTTGCAAAAAGACAACCTG
 
. : . : . : . : . : . :
JMSF024N21+ TGCAAGCGGTAGCCCCACAGTCTTCTTTTAACAAAGCTGCTGATCATTCGGAGTGGCAAG
                      ____________________________________________________________
consensus TGCAAGCGGTAGCCCCACAGTCTTCTTTTAACAAAGCTGCTGATCATTCGGAGTGGCAAG
 
. : . : . : . : . : . :
JMSF024N21+ GTACACCAGAACCTACTGGTCAGCCGCCATCAGCACCTTCTAATAATGTTGAAAAGTCTG
JMSF003M18+ CCATCAGCACCTTCTAATAATGTTGAAAAGTCTG
                      ____________________________________________________________
consensus GTACACCAGAACCTACTGGTCAGCCGCCATCAGCACCTTCTAATAATGTTGAAAAGTCTG
 
. : . : . : . : . : . :
JMSF024N21+ GAGCAGAAGTAGAAGAAGAGTTTTCTGCTCTGGAAGATGAATTCGAAGTGAAGTCAGTGT
JMSF003M18+ GAGCAGAAGTAGAAGAAGAGTTTTCTGCTCTGGAAGATGAATTCGAAGTGAAGTCAGTGT
                      ____________________________________________________________
consensus GAGCAGAAGTAGAAGAAGAGTTTTCTGCTCTGGAAGATGAATTCGAAGTGAAGTCAGTGT
 
. : . : . : . : . : . :
JMSF024N21+ ATGTGAGAAATTTACCAACAACAATGGATCCTTATGAAATTGAAGAGGAGTTTAAAAAAT
JMSF003M18+ ATGTGAGAAATTTACCAACAACAATGGATCCTTATGAAATTGAAGAGGAGTTTAAAAAAT
                      ____________________________________________________________
consensus ATGTGAGAAATTTACCAACAACAATGGATCCTTATGAAATTGAAGAGGAGTTTAAAAAAT
 
. : . : . : . : . : . :
JMSF024N21+ TTGGTAAACTGAAGCCTGATGGTGTCGCTATTAGAACACGGAAGGATATTGATGTGTGCT
JMSF003M18+ TTGGTAAACTGAAGCCTGATGGTGTCGCTATTAGAACACGGAAGGATATTGATGTGTGCT
                      ____________________________________________________________
consensus TTGGTAAACTGAAGCCTGATGGTGTCGCTATTAGAACACGGAAGGATATTGATGTGTGCT
 
. : . : . : . : . : . :
JMSF024N21+ ATGCATTTGTTGAATTTGAAGATGTAACAAGTGTACAGAATGCAATCAAGGCTTCTACTG
JMSF003M18+ ATGCATTTGTTGAATTTGAAGATGTAACAAGTGTACAGAATGCAATCAAGGCTTCTACTG
                      ____________________________________________________________
consensus ATGCATTTGTTGAATTTGAAGATGTAACAAGTGTACAGAATGCAATCAAGGCTTCTACTG
 
. : . : . : . : . : . :
JMSF024N21+ TACAGATTGGTGGACACCAGCTATATATTGAAGGGAGAAGACCAAACAGAAA
JMSF003M18+ TACAGATTGGTGGACACCAGCTATATATTGAAGGGAGAAGACCAAACAGAAATAGCTTTT
                      ____________________________________________________________
consensus TACAGATTGGTGGACACCAGCTATATATTGAAGGGAGAAGACCAAACAGAAATAGCTTTT