Previous Contig 004545:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003L07Sequence155004545 (2)740011277 (2)gb:AB017063_15133313e-66Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K3K7.
JMSF043I01Sequence137004545 (2)696011277 (2)gb:AB017063_15133314e-61Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K3K7.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043I01+ AAAAAAAAAAAAAGGAAGGA
JMSF003L07+ TTTGGGGGNGNTTTNAAAAAAAAAAAAAGGAAGGA
                      ____________________________________________________________
consensus TTTGGGGGNGNTTTNAAAAAAAAAAAAAGGAAGGA
 
. : . : . : . : . : . :
JMSF043I01+ ACTTTAAGGAAGAAAGAGAGGCGGAGAGCGATGGGTTCTAAGGTTTCTTCATGCCCACAT
JMSF003L07+ ACTTTAAGGAAGAAAGAGAGGCGGAGAGCGATGGGTTCTAAGGTTTCTTCATGCCCACAT
                      ____________________________________________________________
consensus ACTTTAAGGAAGAAAGAGAGGCGGAGAGCGATGGGTTCTAAGGTTTCTTCATGCCCACAT
 
. : . : . : . : . : . :
JMSF043I01+ CGGATTCTTGAAATTTAATGTTGGGATTCAGGTGGGTGGAGGCTGGATTACGTT
JMSF003L07+ CGGATTCTTGAAATTTAATGTTGGGATTCAGGTGGGTGGAGGCTGGATTACGTTGATCTC
                      ____________________________________________________________
consensus CGGATTCTTGAAATTTAATGTTGGGATTCAGGTGGGTGGAGGCTGGATTACGTTGATCTC