Previous Contig 004544:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031P18Sequence577004544 (9)pir|T52392|T523921e-45hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584745009696 (7)pir|T52392|T523922e-43hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584
JMFN007O04Sequence618004544 (9)pir|T52392|T523921e-48hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584
JMSF003L05Sequence380004544 (9)726009696 (7)pir|T52392|T523923e-43hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584
JMSF005D15Sequence234004544 (9)
JMSF006G03Sequence386004544 (9)pir|T52392|T523923e-40hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584
JMSF006G18Sequence440004544 (9)pir|T52392|T523921e-31hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584
JMSF008F01Sequence409004544 (9)pir|T52392|T523927e-31hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584804009696 (7)pir|T52392|T523925e-47hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584
JMSF012L19Sequence429004544 (9)pir|T52392|T523921e-44hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584724009696 (7)pir|T52392|T523921e-41hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584
JMSF023D13Sequence672004544 (9)pir|T52392|T523921e-52hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584709009696 (7)pir|T52392|T523923e-43hypothetical protein MMB12.11 [imported] - Arabidopsis thaliana>gb:AY150288_1584

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN007O04+ AGCTTGATTCCATCCCGGTTATCTTCAACTTGCT
JMSF023D13+ CAAATTCAAAGGGAAGAAGCTTGATTCCATCCCGGTTATCTTCAACTTGCT
                      ____________________________________________________________
consensus CAAATTCAAAGGGAAGAAGCTTGATTCCATCCCGGTTATCTTCAACTTGCT
 
. : . : . : . : . : . :
JMFN007O04+ GATTTGCATCTCCCTTGCCCTCCTCATCCTTGCCTGGATAGTTTGAACGGCTAGCTCTTT
JMFF031P18+ TGGATAGTTTGAACGGCTAGCTCTTT
JMSF023D13+ GATTTGCATCTCCCTTGCCCTCCTCACCCTTGCCTGGATAGTTTGAACGGCTAGCTCTTT
                      ____________________________________________________________
consensus GATTTGCATCTCCCTTGCCCTCCTCATCCTTGCCTGGATAGTTTGAACGGCTAGCTCTTT
 
. : . : . : . : . : . :
JMFN007O04+ GTGATTGTGAATCTTCTATAGCATACAGGTTTCCCCAGTCTACATTATTGCCTCCAATTC
JMFF031P18+ GTGATTGTGAATCTTCTATAGCATACAGGTTTCCCCAGTCTACATTATTGCCTCCAATTC
JMSF023D13+ GTGATTGTGAATCTTCTATAGCATACAGGTTTCCCCAGTCTACATTATTGCCTCCAATTC
                      ____________________________________________________________
consensus GTGATTGTGAATCTTCTATAGCATACAGGTTTCCCCAGTCTACATTATTGCCTCCAATTC
 
. : . : . : . : . : . :
JMFN007O04+ CAGTTTCCTGGGACTTGGTAGCCTGGTGGTGGCGCAGGATTCTGCGCTGAAGCTCTTCAA
JMSF012L19+ GGGACTTGGTAGCCTGGTGGTGGCGCAGGATTTTGCGCTGAAGCTCTTCAA
JMSF006G03+ TGCGCTGAAGCTCTTCAA
JMFF031P18+ CAGTTTCCTGGGACTTGGTAGCCTGGTGGTGGCGCAGGATTCTGCGCTGAAGCTCTTCAA
JMSF023D13+ CAGTTTCCTGGGACTTGGTAGCCTGGTGGTGGCGCAGGATTCTGCGCTGAAGCTCTTCAA
                      ____________________________________________________________
consensus CAGTTTCCTGGGACTTGGTAGCCTGGTGGTGGCGCAGGATTCTGCGCTGAAGCTCTTCAA
 
. : . : . : . : . : . :
JMFN007O04+ CAAAAGGGGCAACGGAGGGATCTTTGGCGTTAAGGAGAAGGACCTCTTGGGCGGTGATTA
JMSF012L19+ CAAAAGGGGCAACGGAGGGATCTTTGGCGTTAAGGAGAAGGACCTCTTGGGCGGTGATTA
JMSF006G03+ CAAAAGGGGCAACGGAGGGATCTTTGGCGTTAAGGAGAAGGACCTCTTGGGCGGTGATTA
JMFF031P18+ CAAAAGGGGCAACGGAGGGATCTTTGGCGTTAAGGAGAAGGACCTCTTGGGCGGTGATTA
JMSF023D13+ CAAAAGGGGCAACGGAGGGATCTTTGGCGTTAAGGAGAAGGACCTCTTGGGCGGTGATTA
JMSF008F01+ AGGAGAAGGACNTCTTGGGCGGTGATTA
JMSF006G18+ GGAGAAGGACCTCTTGGGCGGTGATTA
                      ____________________________________________________________
consensus CAAAAGGGGCAACGGAGGGATCTTTGGCGTTAAGGAGAAGGACCTCTTGGGCGGTGATTA
 
. : . : . : . : . : . :
JMFN007O04+ TGGCCTTGATGTGTTCCAAGTTGATGACGATGGCTCGTTCACGGCCGAGAACGGTGGAGG
JMSF012L19+ TGGCCTTGATGTGTTCCAAGTTGATGACGATGGCTCGTTCACGGCCGAGAACGGTGGAGG
JMSF006G03+ TGGCCTTGATGTGTTCCAAGTTGATGACGATGGCTCGTTCACGGCCGAGAACGGTGGAGG
JMFF031P18+ TGGCCTTGATGTGTTCCAAGTTGATGACGATGGCTCGTTCACGGCCGAGAACGGTGGAGG
JMSF023D13+ TGGCCTTGATGTGTTCCAAGTTGATGACGATGGCTCGTTCACGGCCGAGAACGGTGGAGG
JMSF008F01+ TGGCCTTGATGTGTTCCAAGTTGATGACGATGGCTCGTTCACGGCCGAGAACGGTGGAGG
JMSF006G18+ TGGCCTTGATGTGTTCCAAGTTGATGACGATGGCTCGTTCACGGCCGAGAACGGTGGAGG
                      ____________________________________________________________
consensus TGGCCTTGATGTGTTCCAAGTTGATGACGATGGCTCGTTCACGGCCGAGAACGGTGGAGG
 
. : . : . : . : . : . :
JMFN007O04+ GGTAGGAGAGAAGTGGGTCCAGTATACGAAGATCGCGGCCAGGAAGTCCCGTCCGCCGCA
JMSF012L19+ GGTAGGAGAGAAGTGGGTCCAGTATACGAAGATCGCGGCCAGGAAGTCCCGTCCGCCGCA
JMSF006G03+ GGTAGGAGAGAAGTGGGTCCAGTATACGAAGATCGCGGCCAGGAAGTCCCGTCCGCCGCA
JMFF031P18+ GGTAGGAGAGAAGTGGGTCCAGTATACGAAGATCGCGGCCAGGAAGTCCCGTCCGCCGCA
JMSF023D13+ GGTAGGAGAGAAGTGGGTCCAGTATACGAAGATCGCGGCCAGGAAGTCCCGTCCGCCGCA
JMSF008F01+ GGTAGGAGAGAAGTGGGTCCAGTATACGAAGATCGCGGCCAGGAAGTCCCGTCCGCCGCA
JMSF006G18+ GGTAGGAGAGAAGTGGGTCCAGTATACGAAGATCGCGGCCAGGAAGTCCCGTCCGCCGCA
                      ____________________________________________________________
consensus GGTAGGAGAGAAGTGGGTCCAGTATACGAAGATCGCGGCCAGGAAGTCCCGTCCGCCGCA
 
. : . : . : . : . : . :
JMFN007O04+ TAATGGCGTGTTTTCCGGCCTCCACCACCTGCGCCTGCCCTGTGGAGTCCAGTAGAAGCC
JMSF012L19+ TAATGGCGTGTTTTCCGGCCTCCACCACCTGCGCCTGCCCTGTGGAGTCCAGTAGAAGCC
JMSF006G03+ TAATGGCGTGTTTTCCGGCCTCCACCACCTGCGCCTGCCCTGTGGAGTCCAGTAGAAGCC
JMFF031P18+ TAATGGCGTGTTTTCCGGCCTCCACCACCTGCGCCTGCCCTGTGGAGTCCAGTAGAAGCC
JMSF023D13+ TAATGGCGTGTTTTCCGGCCTCCACCACCTGCGCCTGCCCTGTGGAGTCCAGTAGAAGCC
JMSF008F01+ TAATGGCGTGTTTTCCGGCCTCCACCACCTGCGCCTGCCCTGTGGAGTCCAGTAGAAGCC
JMSF006G18+ TAATGGCGTGTTTTCCGGCCTCCACCACCTGCGCCTGCCCTGTGGAGTCCAGTAGAAGCC
JMSF003L05+ TGTGGAGTCCAGTAGAAGCC
                      ____________________________________________________________
consensus TAATGGCGTGTTTTCCGGCCTCCACCACCTGCGCCTGCCCTGTGGAGTCCAGTAGAAGCC
 
. : . : . : . : . : . :
JMFN007O04+ ATGACCGGACTCCCGACGCCTTCTTTCGCAGTCCACTCCCAATGCCCGGGACGGCGGCGT
JMSF012L19+ ATGACCGGACTCCCGACGCCTTCTTTCGCAGTCCACTCCCAATGCCCGGGACGGCGGCGT
JMSF006G03+ ATGACCGGACTCCCGACGCCTTCTTTCGCAGTCCACTCCCAATGCCCGGGACGGCGGCGT
JMFF031P18+ ATGACCGGACTCCCGACGCCTTCTTTCGCAGTCCACTCCCAATGCCCGGGACGGCGGCGT
JMSF023D13+ ATGACCGGACTCCCGACGCCTTCTTTCGCAGTCCACTCCCAATGCCCGGGACGGCGGCGT
JMSF008F01+ ATGACCGGACTCCCGACGCCTTCTTTCGCAGTCCACTCCCAATGCCCGGGACGGCGGCGT
JMSF006G18+ ATGACCGGACTCCCGACGCCTTCTTTCGCAGTCCACTCCCAATGCCCGGGACGGCGGCGT
JMSF005D15+ GGCGGCGT
JMSF003L05+ ATGACCGGACTCCCGACGCCTTCTTTCGCAGTCCACTCCCAATGCCCGGGACGGCGGCGT
                      ____________________________________________________________
consensus ATGACCGGACTCCCGACGCCTTCTTTCGCAGTCCACTCCCAATGCCCGGGACGGCGGCGT
 
. : . : . : . : . : . :
JMFN007O04+ TGTGCCCGTCGTCGTCGACCGCCGGCGCTGCGTTGACTTTAGTTGGAGGAGGGCCCCTCA
JMSF012L19+ TGTGCCCGTCGTCGTCGACCGCCGGCGCTGCGTTGACTTTAGTTGGAGGAGGGCCCCTCA
JMSF006G03+ TGTGCCCGTCGTCGTCGACCGCCGGCGCTGCGTTGACTTTAGTTGGAGGAGGGCCCCTCA
JMFF031P18+ TGTGCCCGTCGTCGTCGACCGCCGGCGCTGCGTTGACTTTAGTTGGAGGAGGGCCCCTCA
JMSF023D13+ TGTGCCCGTCGTCGTCGACCGCCGGCGCTGCGTTGACTTTAGTTGGAGGAGGGCCCCTCA
JMSF008F01+ TGTGCCCGTCGTCGTCGACCGCCGGCGCTGCGTTGACTTTAGTTGGAGGAGGGCCCCTCA
JMSF006G18+ TGTGCCCGTCGTCGTCGACCGCCGGCGCTGCGTTGACTTTAGTTGGAGGAGGGCCCCTCA
JMSF005D15+ TGTGCCCGTCGTCGTCGACCGCCGGCGCTGCGTTGACTTTAGTTGGAGGAGGGCCCCTCA
JMSF003L05+ TGTGCCCGTCGTCGTCGACCGCCGGCGCTGCGTTGACTTTAGTTGGAGGAGGGCCCCTCA
                      ____________________________________________________________
consensus TGTGCCCGTCGTCGTCGACCGCCGGCGCTGCGTTGACTTTAGTTGGAGGAGGGCCCCTCA
 
. : . : . : . : . : . :
JMFN007O04+ TCATTACGCGTGTTCGAGCTTGAGTAGCCTAAATTTGACGTCTA
JMSF012L19+ TCATTACGCGTGTTCGA
JMSF006G03+ TCATTAC
JMFF031P18+ TCATTACGCGTGTTCGAGCTTGAGTAGCCTAAATTTGACGTCTAGTAAAGCTTCAAATTC
JMSF023D13+ TCATTACGCGTGTTCGAGCTTGAGTAGCCTAAATTTGACGTCTAGTAAAGCTTCAAATTC
JMSF008F01+ TCATTACGCGTGTTCGAGCTTGAGTAGCCTAAATTTGACGTCTAGTAAAGCTTCAAATTC
JMSF006G18+ TCATTACGCGTGTTCGAGCTTGAGTAGCCTAAATTTGACGTCTAGTAAAGCTTCAAATTC
JMSF005D15+ TCATTACGCGTGTTCGAGCTTGAGTAGCCTAAATTTGACGTCTAGTAAAGCTTCAAATTC
JMSF003L05+ TCATTACGCGTGTTCGAGCTTGAGTAGCCTAAATTTGACGTCTAGTAAAGCTTCAAATTC
                      ____________________________________________________________
consensus TCATTACGCGTGTTCGAGCTTGAGTAGCCTAAATTTGACGTCTAGTAAAGCTTCAAATTC
 
. : . : . : . : . : . :
JMFF031P18+ CATGGTGCAC
JMSF023D13+ CATGGTGCACAGGAATCAAC
JMSF008F01+ CATGGTGCACAGGAATCAAC
JMSF006G18+ CATGGTGCACAGGAATCAACGAATCTCTCTACATGGCTACTTTCACACCAAT
JMSF005D15+ CATGGTGCACAGGAATCAACGAATCTCTCTACATGGCTACTTTCACACCAATAAGGAAAA
JMSF003L05+ CATGGTGCACAGGAATCAACGAATCTCTCTACATGGCTACTTTCACACCAATAAGGAAAA
                      ____________________________________________________________
consensus CATGGTGCACAGGAATCAACGAATCTCTCTACATGGCTACTTTCACACCAATAAGGAAAA
 
. : . : . : . : . : . :
JMSF005D15+ TAATTTACCACAAAAAATATTCGAAGCATCTATCGTTTTCAATTT
JMSF003L05+ TAATTTACCACAAAAAATATTCGAAGCATCTATCGTTTTCAATTTACTTTGTCGGCAGTG
                      ____________________________________________________________
consensus TAATTTACCACAAAAAATATTCGAAGCATCTATCGTTTTCAATTTACTTTGTCGGCAGTG
 
. : . : . : . : . : . :
JMSF003L05+ TCATGCCTGGCTTTTACCTCTTGTAGGTGATTTTCTCTCTAGTTATTTGTTCAAGTTGTC
                      ____________________________________________________________
consensus TCATGCCTGGCTTTTACCTCTTGTAGGTGATTTTCTCTCTAGTTATTTGTTCAAGTTGTC