Previous Contig 004537:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039P05Sequence405004537 (9)gb:SORPL235_17158834e-09S.oleracea mRNA for ribosomal protein L23 (578bp).734004537 (9)gb:SORPL235_17158837e-18S.oleracea mRNA for ribosomal protein L23 (578bp).
JMFN006I06Sequence610004537 (9)gb:SORPL235_17158835e-10S.oleracea mRNA for ribosomal protein L23 (578bp).
JMSF002D22Sequence346004537 (9)723004537 (9)gb:SORPL235_17158837e-18S.oleracea mRNA for ribosomal protein L23 (578bp).
JMSF003K09Sequence481004537 (9)718004537 (9)gb:SORPL235_17158837e-18S.oleracea mRNA for ribosomal protein L23 (578bp).
JMSF009N18Sequence340004537 (9)722004537 (9)gb:SORPL235_17158832e-17S.oleracea mRNA for ribosomal protein L23 (578bp).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009N18- AAGATCATAACAAAAAACTCCAAATCATTCAAGGGAAACCAAGGGTTT
rJMSF003K09- AATCATTCAAGGGAAACCAAGGGTTT
rJMSF002D22- GTTT
rJMFF039P05- GTTT
                      ____________________________________________________________
consensus AAGATCATAACAAAAAACTCCAAATCATTCAAGGGAAACCAAGGGTTT
 
. : . : . : . : . : . :
rJMSF009N18- TTTTCTAGGATGAGCAGTCAATCAGGATCTAGATTTCACTTGTGTGCAAGGAAGAATTAA
rJMSF003K09- TTTTCTAGGATGAGCAGTCAATCAGGATCTAGATTTCACTTGTGTGCAAGGAAGAATTAA
rJMSF002D22- TTTTCTAGGATGAGCAGTCAATCAGGATCTAGATTTCACTTGTGTGCAAGGAAGAATTAA
rJMFF039P05- TTTTCTAGGATGAGCAGTCAATCAGGATCTAGATTTCACTTGTGTGCAAGGAAGAATTAA
                      ____________________________________________________________
consensus TTTTCTAGGATGAGCAGTCAATCAGGATCTAGATTTCACTTGTGTGCAAGGAAGAATTAA
 
. : . : . : . : . : . :
rJMSF009N18- CATTTTGATACAAACTCAGGTGAAGAAGCAAAGAACCCATTTTTGTTCTAAATGACTTTA
rJMSF003K09- CATTTTGATACAAACTCAGGTGAAGAAGCAAAGAACCCATTTTTGTTCTAAATGACTTTA
rJMSF002D22- CATTTTGATACAAACTCAGGTGAAGAAGCAAAGAACCCATTTTTGTTCTAAATGACTTTA
rJMFF039P05- CATTTTGATACAAACTCAGGTGAAGAAGCAAAGAACCCATTTTTGTTCTAAATGACTTTA
                      ____________________________________________________________
consensus CATTTTGATACAAACTCAGGTGAAGAAGCAAAGAACCCATTTTTGTTCTAAATGACTTTA
 
. : . : . : . : . : . :
rJMSF009N18- ATTCTTTTAGCCACATCCACTGCACTTTGATCTGGTGCCAATATAAGGAGTGCTTTCTTG
rJMSF003K09- ATTCTTTTAGCCACATCCACTGCACTTTGATCTGGTGCCAATATAAGGAATGCTTTCTTG
rJMSF002D22- ATTCTTTTAGCCACATCCACTGCACTTTGATCTGGTGCCAATATAAGGAATGCTTTCTTG
rJMFF039P05- ATTCTTTTAGCCACATCCACTGCACTTTGATCTGGTGCCAATATAAGGAATGCTTTCTTG
                      ____________________________________________________________
consensus ATTCTTTTAGCCACATCCACTGCACTTTGATCTGGTGCCAATATAAGGAATGCTTTCTTG
 
. : . : . : . : . : . :
rJMSF009N18- GTTCCATCAGGCAGGATCGACGTGTTTACCTTCTTGATCTTAATCTTGAATATCT-TCGA
rJMSF003K09- GTTCCATCAGGCAGGATCGACGTGTTTACCTTCTTGATCTTAATCTTGAATATCT-TCGA
rJMSF002D22- GTTCCATCAGGCAGGATCGACGTGTTTACCTTCTTGATCTTAATCTTGAATATCT-TCGA
JMFF039P05+ TCGA
rJMFF039P05- GTTCCATCAGGCAGGATCGACGTGTTTACCTTCTTGATCTTAATCTTGAATATCT-TCGA
JMFN006I06+ CTTGATCTTAATC-TGAATATCTNTCGA
                      ____________________________________________________________
consensus GTTCCATCAGGCAGGATCGACGTGTTTACCTTCTTGATCTTAATCTTGAATATCT-TCGA
 
. : . : . : . : . : . :
rJMSF009N18- GGCAGAATCCTTTATGATTGTCTTGTCAGCACGCTTGTCGACAGCAAAAACCAGGGTGTT
rJMSF003K09- GGCAGAATCCTTTATGATTGTCTTGTCAGCACGCTTGTCGACAGCAAAAACCAGGGTGTT
rJMSF002D22- GGCAGAATCCTTTATGATTGTCTTGTCAGCACGCTTGTCGACAGCAAAAACCAGGGTGTT
JMFF039P05+ GGCAGAATCCTTTATGATTGTCTNGTCAGCACGCTTGTCGACAGCAAAAACCAGGGTGTT
rJMFF039P05- GGCAGAATCCTTTATGATTGTCTTGTCAGCACGCTTGTCGACAGCAAAAACCAGGGTGTT
JMFN006I06+ GGCAGAATCCTTTATGATTGTCTTGTCAGCACGCTTGTCGACAGCAAAAACCAGGGTGTT
                      ____________________________________________________________
consensus GGCAGAATCCTTTATGATTGTCTTGTCAGCACGCTTGTCGACAGCAAAAACCAGGGTGTT
 
. : . : . : . : . : . :
rJMSF009N18- TTTCTGTAGAATATTTTTCATTCCAGCCTCGGTGACGATGGGATACTTGAGAATCTGCGA
rJMSF003K09- TTTCTGTAGAATATTTTTCATTCCAGCCTCGGTGACGATGGGATACTTGAGAATCTGCGA
rJMSF002D22- TTTCTGTAGAATATTTTTCATTCCAGCCTCGGTGACGATGGGATACTTGAGAATCTGCGA
JMFF039P05+ TTTCTGTAGAATATTTTTCATTCCAGCCTCGGTGACGATGGGATACTTGAGAATCTGCGA
rJMFF039P05- TTTCTGTAGAATATTTTTCATTCCAGCCTCGGTGACGATGGGATACTTGAGAATCTGCGA
JMFN006I06+ TTTCTGTAGAATATTTTTCATTCCAGCCTCGGTGACGATGGGATACTTGAGAATCTGCGA
JMSF003K09+ TGCGA
                      ____________________________________________________________
consensus TTTCTGTAGAATATTTTTCATTCCAGCCTCGGTGACGATGGGATACTTGAGAATCTGCGA
 
. : . : . : . : . : . :
rJMSF009N18- ATAATCTAGCGTTGTGGTCCTTTGAGAAGCAAGGCTGTTGAGAAGTTTGGGGTTCCTTCC
rJMSF003K09- ATAATCTAGCGTTGTGGTCCTTTGAGAAGCAAGGCTGTTGAGAAGTTTGGGGTTCCTTCC
rJMSF002D22- ATAATCTAGCGTTGTGGTCCTTTGAGAAGCAAGGCTGTTGAGAAGTTTGGGGTTCCTTCC
JMFF039P05+ ATAATCTAGCGTTGTGGTCCTTTGAGAAGCAAGGCTGTTGAGAAGTTTGGGGTTCCTTCC
rJMFF039P05- ATAATCTAGCGTTGTGGTCCTTTGAGAAGCAAGGCTGTTGAGAAGTTTGGGGTTCCTTCC
JMFN006I06+ ATAATCTAGCGTTGTGGTCCTTTGAGAAGCAAGGCTGTTGAGAAGTTTGGGGTTCCTTCC
JMSF003K09+ ATAATCNAGCGTTGTGGTCCTTTGAGAAGCAAGGCTGTTGAGAAGTTTGGGGTTCCTTCC
                      ____________________________________________________________
consensus ATAATCTAGCGTTGTGGTCCTTTGAGAAGCAAGGCTGTTGAGAAGTTTGGGGTTCCTTCC
 
. : . : . : . : . : . :
rJMSF009N18- CTTCTTCGATGTCCTAGCTGGCTTGGACGACGTTTTGACTTCTAAAACCCCAATATTCAG
rJMSF003K09- CTTCTTCGATGTCCTAGCTGGCTTGGACGACGTTTTGACTTCTAAAACCCCAATATTCAG
rJMSF002D22- CTTCTTCGATGTCCTAGCTGGCTTGGACGACGTTTTGACTTCTAAAACCCCAATATTCAG
JMFF039P05+ CTTCTTCGATGTCCTAGCTGGCTTGGACGACGTTTTGACTTCTAAAACCCCAATATTCAG
rJMFF039P05- CTTCTTCGATGTCCTAGCTGGCTTGGACGACGTTTTGACTTCTAAAACCCCAATATTCAG
JMSF002D22+ ATATTCAG
JMFN006I06+ CTTCTTCGATGTCCTAGCTGGCTTGGACGACGTTTTGACTTCTAAAACCCCAATATTCAG
JMSF003K09+ CTTCTTCGATGTCCTAGCTGGCTTGGACGACGTTTTGACTTCTAAAACCCCAATATTCAG
                      ____________________________________________________________
consensus CTTCTTCGATGTCCTAGCTGGCTTGGACGACGTTTTGACTTCTAAAACCCCAATATTCAG
 
. : . : . : . : . : . :
rJMSF009N18- AGTCTCTTTAGGTGGATCGAGATATTCTGGCTCGAACGTTGTCTCAGATTTGGTTTCACT
rJMSF003K09- AGTCTCTTTAGGTGGATCGAGATATTCTGGCTCGAACGTTGTCTCAGATTTGGTTTCACT
rJMSF002D22- AGTCTCTTTAGGTGGATCGAGATATTCTGGCTCGAACGTTGTCTCAGATTTGGTTTCACT
JMFF039P05+ AGTCTCTTTAGGTGGATCGAGATATTCTGGCTCGAACGTTGTCTCAGATTTGGTTTCACT
rJMFF039P05- AGTCTCTTTAGGTGGATCGAGATATTCTGGCTCGAACGTTGTCTCAGATTTGGTTTCACT
JMSF002D22+ AGTCTCTTTAGGTGGATCGAGATATTCTGGCTCGAACGTTGTCTCAGATTTGGTTTCACT
JMFN006I06+ AGTCTCTTTAGGTGGATCGAGATATTCTGGCTCGAACGTTGTCTCAGATTTGGTTTCACT
JMSF009N18+ GATCGAGATATTCTGGCTCGAACGTTGTCTCAGATTTGGTTTCACT
JMSF003K09+ AGTCTCTTTAGGTGGATCGAGATATTCTGGCTCGAACGTTGTCTCAGATTTGGTTTCACT
                      ____________________________________________________________
consensus AGTCTCTTTAGGTGGATCGAGATATTCTGGCTCGAACGTTGTCTCAGATTTGGTTTCACT
 
. : . : . : . : . : . :
rJMSF009N18- GGAACTCTCGACTTGAGGAGTCAGGGAATGCACCAAAACCCTTCGAAGAAAATGGGAGTT
rJMSF003K09- GGAACTCTCGACTTGAGGAGTCAGGGAATGCACCAAAACCCTTCGAAGAAAATGGGAGTT
rJMSF002D22- GGAACTCTCGACTTGAGGAGTCAGGGAATGCACCAAAACCCTTCGAAGAAAATGGGAGTT
JMFF039P05+ GGAACTCTCGACTTGAGGAGTCAGGGAATGCACCAAAACCCTTCGAAGAAAATGGGAGTT
rJMFF039P05- GGAACTCTCGACTTGAGGAGTCAGGGAATGCACCAAAACCCTTCGAAGAAAATGGGAGTT
JMSF002D22+ GGAACTCTCGACTTGAGGAGTCAGGGAATGCACCAAAACCCTTCGAAGAAAATGGGAGTT
JMFN006I06+ GGAACTCTCGACTTGAGGAGTCAGGGAATGCACCAAAACCCTTCGAAGAAAATGGGAGTT
JMSF009N18+ GGAACTCTCGACTTGAGGAGTCAGGGAATGCACCAAAACCCTTCGAAGAAAATGGGAGTT
JMSF003K09+ GGAACTCTCGACTTGAGGAGTCAGGGAATGCACCAAAACCCTTCGAAGAAAATGGGAGTT
                      ____________________________________________________________
consensus GGAACTCTCGACTTGAGGAGTCAGGGAATGCACCAAAACCCTTCGAAGAAAATGGGAGTT
 
. : . : . : . : . : . :
rJMSF009N18- CCCGGAATGTAGGCTTACAGGCTCGGTATGTGAAGAGTAACCTATTAAAGACCGGAGCTT
rJMSF003K09- CCCGGAATGTAGGCTTACAGGCTCGGTATGTGAAGAGTAACCTATTAAAGACCGGAGCTT
rJMSF002D22- CCCGGAATGTAGGCTTACAGGCTCGGTATGTGAAGAGTAACCTATTAAAGACCGGAGCTT
JMFF039P05+ CCCGGAATGTAGGCTTACAGGCTCGGTATGTGAAGAGTAAC
rJMFF039P05- CCCGGAATGTAGGCTTACAGGCTCGGTATGTGAAGAGTAACCTATTAAAGACCGGAGCTT
JMSF002D22+ CCCGGAATGTAGGCTTACAGGCTCGGTATGTGAAGAGTAACCTATTAAAGACCGGAGCTT
JMFN006I06+ CCCGGAATGTAGGCTTACAGGCTCGGTATGTGAAGAGTAACCTATTAAAGACCGGAGCTT
JMSF009N18+ CCCGGAATGTAGGCTTACAGGCTCGGTATGTGAAGAGTAACCTATTAAAGACCGGAGCTT
JMSF003K09+ CCCGGAATGTAGGCTTACAGGCTCGGTATGTGAAGAGTAACCTATTAAAGACCGGAGCTT
                      ____________________________________________________________
consensus CCCGGAATGTAGGCTTACAGGCTCGGTATGTGAAGAGTAACCTATTAAAGACCGGAGCTT
 
. : . : . : . : . : . :
rJMSF009N18- T-TAGCAGGTAAAGCA
rJMSF003K09- TCT---AGGTAAAGCAGGGTCCAGGGCGCCA
rJMSF002D22- TCTAGCAGGTAAAGCAGGGTCCAGGGCGCCACCGGAGAAGGATACCTTGTAA-GGAA
rJMFF039P05- TCTAGCAGGTAAAGCAGGGTCCAGGGCGCCACCGGAGAAGGATACCTTGTAAGGGAAGGA
JMSF002D22+ TCTAGCAGGTAAAGCAGGGTCCAGGGCGCCACCGGAGAAGGATACCTTGTAA-GGAAGGA
JMFN006I06+ TCTAGCAGGTAAAGCAGGGTCCAGGGCGCCACCGGAGAAGGATACCTTGTAA-GGAAGGA
JMSF009N18+ T-TAGCAGGTAAAGCAGGGTCCAGGGCGCCACCGGAGAAGGATACCTTGTAA-GGAAGGA
JMSF003K09+ T-C--TAGGTAAAGCAGGGTCCAGGGCGCCACCGGAGAAGGATACCTTGTAA-GGAAGGA
                      ____________________________________________________________
consensus TCTAGCAGGTAAAGCAGGGTCCAGGGCGCCACCGGAGAAGGATACCTTGTAA-GGAAGGA
 
. : . : . : . : . : . :
rJMFF039P05- AAGTCCTCGTC
JMSF002D22+ AAGTCCTCGTCGCTGGGCCGGACGGCGTAAAGGTGCGATCTTGTCGCTGGGTCGGAGAAG
JMFN006I06+ AAGTCCTCGTCGCTGGGCCGGACGGCGTAAAGGTGCGATCTTGTCGCTGGGTCGGAGAAG
JMSF009N18+ AAGTCCTCGTCGCTGGGCCGGACGGCGTAAAGGTGCGATCTTGTCGCTGGGTCGGAGAAG
JMSF003K09+ AAGTCCTCGTCGCTGGGCCGGACGGCGTAAAGGTGCGATCTTGTCGCTGGGTCGGAGAAG
                      ____________________________________________________________
consensus AAGTCCTCGTCGCTGGGCCGGACGGCGTAAAGGTGCGATCTTGTCGCTGGGTCGGAGAAG
 
. : . : . : . : . : . :
JMSF002D22+ AACCAAACACCGGAAGGGTAATTGTAGACGCCATTATC
JMFN006I06+ AACCAAACACCGGAAGGGTAATTGTAGACGCCATTATC
JMSF009N18+ AACCAAACACCGGAAGGGTAATTGTAGACGCCATTATCACTTCAGATAATCGGGT
JMSF003K09+ AACCAAACACCGGAAGGGTAATTGTAGACGCCATTATCACTTCAGATAATCGGGTGAAGC
                      ____________________________________________________________
consensus AACCAAACACCGGAAGGGTAATTGTAGACGCCATTATCACTTCAGATAATCGGGTGAAGC