Previous Contig 004536:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016F02Sequence615004536 (9)pir|C85360|C853602e-21hypothetical protein AT4g30780 [imported] - Arabidopsis thaliana>gb:ATCHRIV73_15720010310 (8)gb:AP003508_18300628e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMFF030I17Sequence536004536 (9)pir|C85360|C853604e-06hypothetical protein AT4g30780 [imported] - Arabidopsis thaliana>gb:ATCHRIV73_15719010310 (8)gb:AP003508_18300628e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMFF043G20Sequence635004536 (9)pir|C85360|C853603e-26hypothetical protein AT4g30780 [imported] - Arabidopsis thaliana>gb:ATCHRIV73_15559010310 (8)gb:AP003508_18300622e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMSF003K08Sequence310004536 (9)167005356 (6)
JMSF012N24Sequence252004536 (9)776010310 (8)pir|F84632|F846328e-19hypothetical protein At2g24100 [imported] - Arabidopsis thaliana>gb:AY042896_156
JMSF014D21Sequence214004536 (9)
JMSF036C12Sequence656004536 (9)pir|C85360|C853607e-29hypothetical protein AT4g30780 [imported] - Arabidopsis thaliana>gb:ATCHRIV73_15763010310 (8)gb:AP003508_18300623e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMSF037G19Sequence655004536 (9)pir|C85360|C853603e-28hypothetical protein AT4g30780 [imported] - Arabidopsis thaliana>gb:ATCHRIV73_15715010310 (8)gb:AP003508_18300628e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMSF048O14Sequence656004536 (9)pir|C85360|C853607e-29hypothetical protein AT4g30780 [imported] - Arabidopsis thaliana>gb:ATCHRIV73_15755010310 (8)gb:AP003508_18300622e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037G19+ TTGAGCCCACCGTCGAGAACTTCCCAAACCAGCTTGTGCTTCGCGAAGTAACATTTCG
JMSF048O14+ TTGAGCCCACCGTCGAGAACTTCCCAAACCAGCTTGTGCTTCGCAAAGTAACATTTCG
JMFF043G20+ CTTCCCAAACCAGCTTGTGCTTCGCAAAGTAACATTTCG
JMFF016F02+ TTCGCAAAGTAACATTTCG
JMSF036C12+ CTTGAGCCCACCGTCGAGAACTTCCCAAACCAGCTTGTGCTTCGCAAAGTAACATTTCG
                      ____________________________________________________________
consensus CTTGAGCCCACCGTCGAGAACTTCCCAAACCAGCTTGTGCTTCGCAAAGTAACATTTCG
 
. : . : . : . : . : . :
JMSF037G19+ CCACTAAATCACCTTCATACCTAGACTTATACTCCCAGCTACCAATTTTGAGAATCGATG
JMSF048O14+ CCACTAAATCACCTTCATACCTAGACTTATACTCCCAGCTACCAATTTTGAGAATCGATG
JMFF043G20+ CCACTAAATCACCTTCATACCTAGACTTATACTCCCAGCTACCAATTTTGAGAATCGATG
JMFF016F02+ CCACTAAATCACCTTCATACCTAGACTTATACTCCCAGCTACCAATTTTGAGAATCGATG
JMSF036C12+ CCACTAAATCACCTTCATACCTAGACTTATACTCCCAGCTACCAATTTTGAGAATCGATG
                      ____________________________________________________________
consensus CCACTAAATCACCTTCATACCTAGACTTATACTCCCAGCTACCAATTTTGAGAATCGATG
 
. : . : . : . : . : . :
JMSF037G19+ CAGGGAAATTAGACGCCTTAAGCTTCTCGGATGTACTGGAATTGGCCTTCTGTTCCTTTT
JMSF048O14+ CAGGGAAATTAGACGCCTTAAGCTTCTCCGATGTACTGGAATTGGCCTTCTGTTCCTTTT
JMFF043G20+ CAGGGAAATTAGACGCCTTAAGCTTCTCGGATGTACTGGAATTGGCCTTCTGTTCCTTTT
JMFF030I17+ CAGGGAAATTAGACGCCTTAAGCTTCTCGGATGTACTGGAATTGGCCTTCTGTTCCTTTT
JMFF016F02+ CAGGGAAATTAGACGCCTTAAGCTTCTCGGATGTACTGGAATTGGCCTTCTGTTCCTTTT
JMSF036C12+ CAGGGAAATTAGACGCCTTAAGCTTCTCGGATGTACTGGAATTGGCCTTCTGTTCCTTTT
                      ____________________________________________________________
consensus CAGGGAAATTAGACGCCTTAAGCTTCTCGGATGTACTGGAATTGGCCTTCTGTTCCTTTT
 
. : . : . : . : . : . :
JMSF037G19+ TACCAGGATTTCCTCCAGCCTTTGACATCTTCCCTTGAGAAAGCCTCATTTGGATCAAAT
JMSF048O14+ TACCAGGATTTCCTCCAGCCTTTGACATCTTCCCTTGAGAAAGCCTCATTTGGATCAAAT
JMFF043G20+ TACCAGGATTTCCTCCAGCCTTTGACATCTTCCCTTGAGAAAGCCTCATTTGGATCAAAT
JMFF030I17+ TACCAGGATTTCCTCCAGCCTTTGACATCTTCCCTTGAGAAAGCCTCATTTGGATCAAAT
JMFF016F02+ TACCAGGATTTCCTCCAGCCTTTGACATCTTCCCTTGAGAAAGCCTCATTTGGATCAAAT
JMSF036C12+ TACCAGGATTTCCTCCAGCCTTTGACATCTTCCCTTGAGAAAGCCTCATTTGGATCAAAT
                      ____________________________________________________________
consensus TACCAGGATTTCCTCCAGCCTTTGACATCTTCCCTTGAGAAAGCCTCATTTGGATCAAAT
 
. : . : . : . : . : . :
JMSF037G19+ CCAAAAGTGATGGGCTCTTCCTTAAACTCAATCCCAATGGACTTGGCTCCTCTAGCGGGT
JMSF048O14+ CCAAAAGTGATGGGCTCTTCCTTAAACTCAATCCCAATGGACTTGGCTCCTCTAGCGGGT
JMFF043G20+ CCAAAAGTGATGGGCTCTTCCTTAAACTCAATCCCAATGGACTTGGCTCCTCTAGCGGGT
JMFF030I17+ CCAAAAGTGATGGGCTCTTCCTTAAACTCAATCCCAATGGACTTGGCTCCTCTAGCGGGT
JMFF016F02+ CCAAAAGTGATGGGCTCTTCCTTAAACTCAATCCCAATGGACTTGGCTCCTCTAGCGGGT
JMSF036C12+ CCAAAAGTGATGGGCTCTTCCTTAAACTCAATCCCAATGGACTTGGCTCCTCTAGCGGGT
                      ____________________________________________________________
consensus CCAAAAGTGATGGGCTCTTCCTTAAACTCAATCCCAATGGACTTGGCTCCTCTAGCGGGT
 
. : . : . : . : . : . :
JMSF037G19+ TATACTGCACCACCGGAGGTTCCCTGAAATCACTCACTCCAATTCCCACCTGATGCTGAA
JMSF048O14+ TATACTGCACCACCGGAGGTTCCCTGAAATCACTCACTCCAATTCCCACCTGATGCTGAA
JMFF043G20+ TATACTGCACCACCGGAGGTTCCCTGAAATCACTCACTCCAATTCCCACCTGATGCTGAA
JMFF030I17+ TATACTGCACCACCGGAGGTTCCCTGAAATCACTCACTCCAATTCCCACCTGATGCTGAA
JMFF016F02+ TATACTGCACCACCGGAGGTTCCCTGAAATCACTCACTCCAATTCCCACCTGATGCTGAA
JMSF036C12+ TATACTGCACCACCGGAGGTTCCCTGAAATCACTCACTCCAATTCCCACCTGATGCTGAA
JMSF003K08+ TGATGCTGAA
                      ____________________________________________________________
consensus TATACTGCACCACCGGAGGTTCCCTGAAATCACTCACTCCAATTCCCACCTGATGCTGAA
 
. : . : . : . : . : . :
JMSF037G19+ GAGGAGAAGAGAGCTTGGATCGTTTGTTGAGTGGGCCGTGTTCTTCCTCCAAAGGATCAT
JMSF048O14+ GAGGAGAAGAGAGCTTGGATCGTTTGTTGAGTGGGCCGTGTTCTTCCTCCAAAGGATCAT
JMFF043G20+ GAGGAGAAGAGAGCTTGGATCGTTTGTTGAGTGGGCCGTGTTCTTCCTCCAAAGGATCAT
JMFF030I17+ GAGGAGAAGAGAGCTTGGATCGTTTGTTGAGTGGGCCGTGTTCTTCCTCCAAAGGATCAT
JMSF012N24+ CCTCCAAAGGATCAT
JMFF016F02+ GAGGAGAAGAGAGCTTGGATCGTTTGTTGAGTGGGCCGTGTTCTTCCTCCAAAGGATCAT
JMSF036C12+ GAGGAGAAGAGAGCTTGGATCGTTTGTTGAGTGGGCCGTGTTCTTCCTCCAAAGGATCAT
JMSF003K08+ GAGGAGAAGAGAGCTTGGATCGTTTGTTGAGTGGGCCGTGTTCTTCCTCCAAAGGATCAT
                      ____________________________________________________________
consensus GAGGAGAAGAGAGCTTGGATCGTTTGTTGAGTGGGCCGTGTTCTTCCTCCAAAGGATCAT
 
. : . : . : . : . : . :
JMSF037G19+ CGACTTCCACTTCCAGCTTCACCGGCACCGCTTTACCTCTCTGCCAGTCCAGTTCCGGCG
JMSF048O14+ CGACTTCCACTTCCAGCTTCACCGGCACCGCTTTACCTCTCTGCCAGTCCAGTTCCGGCG
JMFF043G20+ CGACTTCCACTTCCAGCTTCACCGGCACCGCTTTACCTCTCTGCCAGTCCAGTTCCGGCG
JMFF030I17+ CGACTTCCACTTCCAGCTTCACCGGCACCGCTTTACCTCTCTGCCAGTCCAGTTCCGGCG
JMSF012N24+ CGACTTCCACTTCCAGCTTCACCGGCACCGCTTTACCTCTCTGCCAGTCCAGTTCCGGCG
JMSF014D21+ GGCACCGCTTTACCTCTTTGCCAGTCCAGTTCGGGCG
JMFF016F02+ CGACTTCCACTTCCAGCTTCACCGGCACCGCTTTACCTCTCTGCCAGTCCAGTTCCGGCG
JMSF036C12+ CGACTTCCACTTCCAGCTTCACCGGCACCGCTTTACCTCTCTGCCAGTCCAGTTCCGGCG
JMSF003K08+ CGANTTCCACTTCCAGCTTCACCGGCACCGCTTTACCTCTCTGCCAGTCCAGTTCCGGCG
                      ____________________________________________________________
consensus CGACTTCCACTTCCAGCTTCACCGGCACCGCTTTACCTCTCTGCCAGTCCAGTTCCGGCG
 
. : . : . : . : . : . :
JMSF037G19+ CCATCTCACCAGTTTTCATCAAGAAAACCATCAAAAGTATATCTCTGATTCAGACCAAGT
JMSF048O14+ CCATCTCACCAGTTTTCATCAAGAAAACCATCAAAAGTATATCTCTGATTCAGACCAAGT
JMFF043G20+ CCATCTCACCAGTTTTCATCAAGAAAACCATCAAAAGTATATCTCTGATTCAGACCAAGT
JMFF030I17+ CCATCTCACCAGTTTTCATCAAGAAAACCATCAAAAGTATATCTCTGATTCAGACCAAGT
JMSF012N24+ CCATCTCACCAGTTTTCATCAAGAAAACCATCAAAAGTATATCTCTGATTCAGACCAAGT
JMSF014D21+ CCATCTCACCAGTNTTCATCAAGAAAACCATCAAAAGTATATCTCTGATTCAGACCAAGT
JMFF016F02+ CCATCTCACCAGTTTTCATCAAGAAAACCATCAAAAGTATATCTCTGATTCAGACCAAGT
JMSF036C12+ CCATCTCACCAGTTTTCATCAAGAAAACCATCAAAAGTATATCTCTGATTCAGACCAAGT
JMSF003K08+ CCATCTCACCAGTTTTCATCAAGAAAACCATCAAAAGTATATCTCTGATTCAGACCAAGT
                      ____________________________________________________________
consensus CCATCTCACCAGTTTTCATCAAGAAAACCATCAAAAGTATATCTCTGATTCAGACCAAGT
 
. : . : . : . : . : . :
JMSF037G19+ AAAGTGCTGGAGCTCGCTGAGTCGACTCGGGATTCGCAGCAAGAGATACGGTGAAGAGAG
JMSF048O14+ AAAGTGCTGGAGCTCGCTGAGTCGACTCGGGATTCGCAGCAAGAGATACGGTGAAGAGAG
JMFF043G20+ AAAGTGCTGGAGCTCGCTGAGTCGACTCGGGATTCGCAGCAAGAGATACGGTGAAGAGAG
JMFF030I17+ AAAGTGCTGGAGCTCGCTGAGTCGACTCGGGATTCGCAGCAAGAGATACGGTGAAGAGAG
JMSF012N24+ AAAGTGCTGGAGCTCGCTGAGTCGACTCGGGATTCGCAGCAAGAGATACGGTGAAGAGAG
JMSF014D21+ AAAGTGCTGGAGCTCGCTGAGTCGACTCGGGATTCGCAGCAAGAGATACGGTGAAGAGAG
JMFF016F02+ AAAGTGCTGGAGCTCGCTGAGTCGACTCGGGATTCGCAGCAAGAGATACGGTGAAGAGAG
JMSF036C12+ AAAGTGCTGGAGCTCGCTGAGTCGACTCGGGATTCGCAGCAAGAGATACGGTGAAGAGAG
JMSF003K08+ AAAGTGCTGGAGCTCGCTGAGTCGACTCGGGATTCGCAGCAAGAGATACGGTGAAGAGAG
                      ____________________________________________________________
consensus AAAGTGCTGGAGCTCGCTGAGTCGACTCGGGATTCGCAGCAAGAGATACGGTGAAGAGAG
 
. : . : . : . : . : . :
JMSF037G19+ AGAGAGAGAGAGGAAAGAGAGAAGAGAAAGCAATGTTCGATTTCACCACTTCTGCT
JMSF048O14+ AGAGAGAGAGAGGAAAGAGAGAAGAGAAAGCAATGTTCGATTTCACCACTTCTGC
JMFF043G20+ AGAGAGAGAGAGGAAAGAGAGAAGAGAAAGCAATGTTCGATTTCACCACTTCTGCT
JMFF030I17+ AGAGAGAGAGAGGAAAGAGAGAAGAGAAAGCAATGTTCGATTTCACCACTTCTGCT
JMSF012N24+ AGAGAGAGAGAGGAAAGAGAGAAGAGAAAGCAATGTTCGATTTCACCACTTCTG
JMSF014D21+ AGAGAGAGAGAGGAAAGAGAGAAGAGAAAGCAATGTTCGATTTCACCACTT
JMFF016F02+ AGAGAGAGAGAGGAAAGAGAGAAGAGAAAGCAATGTTCGATTTCACCACTTCTGCT
JMSF036C12+ AGAGAGAGAGAGGAAAGAGAGAAGAGAAAGCAATGTTCGATTTCACCACTTCTGCT
JMSF003K08+ AGAGAGAGAGAGGAAAGAGAGAAGAGAAAGCAATGTTCGATTTCACCACTTCTGCTACTC
                      ____________________________________________________________
consensus AGAGAGAGAGAGGAAAGAGAGAAGAGAAAGCAATGTTCGATTTCACCACTTCTGCTACTC