Previous Contig 004527:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001J17Sequence366004527 (3)gb:AY072801_15673972e-05Cucurbita maxima phloem calmodulin-like-domain protein kinase PCPK1 mRNA, comple760013767 (4)gb:AY295081_15961511e-75Capsicum annuum calcium-dependent protein kinase 3 mRNA, complete cds.
JMSF003I10Sequence418004527 (3)gb:AY072801_15673972e-05Cucurbita maxima phloem calmodulin-like-domain protein kinase PCPK1 mRNA, comple749013767 (4)gb:AY295081_15961513e-66Capsicum annuum calcium-dependent protein kinase 3 mRNA, complete cds.
JMSF048F19Sequence644004527 (3)gb:AY072801_15673972e-32Cucurbita maxima phloem calmodulin-like-domain protein kinase PCPK1 mRNA, comple774013767 (4)gb:AY295081_15961512e-64Capsicum annuum calcium-dependent protein kinase 3 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048F19+ ATAGACTTACAAGCATAGTCAACACCAGTGGAAATCTCAGTGCA
                      ____________________________________________________________
consensus ATAGACTTACAAGCATAGTCAACACCAGTGGAAATCTCAGTGCA
 
. : . : . : . : . : . :
JMSF048F19+ GAGATAAGTGGTGCCAAATTGACCTTGACCCAACTTACGGCCCAGTGTGTAAAGATCACG
                      ____________________________________________________________
consensus GAGATAAGTGGTGCCAAATTGACCTTGACCCAACTTACGGCCCAGTGTGTAAAGATCACG
 
. : . : . : . : . : . :
JMSF048F19+ GATGTTAGCGGTCTTGTGACCTAGGACGTGATAGGCCTGGTTATTGGTGGAACGATACAT
                      ____________________________________________________________
consensus GATGTTAGCGGTCTTGTGACCTAGGACGTGATAGGCCTGGTTATTGGTGGAACGATACAT
 
. : . : . : . : . : . :
JMSF048F19+ GTTTTCCTTTTTGGGATAAAGTATAGGGATGCGTTGGTCGTCTTTGTTGGGGTTGGGGTT
                      ____________________________________________________________
consensus GTTTTCCTTTTTGGGATAAAGTATAGGGATGCGTTGGTCGTCTTTGTTGGGGTTGGGGTT
 
. : . : . : . : . : . :
JMSF001J17+ GGTTGGGGTGGGTATCCTTGGGGCTCAGCCTAGTAGGGGAGGAGAAATTATCAGAGTA
JMSF048F19+ GGGGTTGGGGTGGGTATCCTTGGGGCTCAGCCTAGTAGGGGAGGAGAAATTATCAGAGTA
JMSF003I10+ GGTTGGGGTGGGTATCCTTGGGGCTCAGCCTAGTAGGGGAGGAGAAATTATCAGAGTA
                      ____________________________________________________________
consensus GGGGTTGGGGTGGGTATCCTTGGGGCTCAGCCTAGTAGGGGAGGAGAAATTATCAGAGTA
 
. : . : . : . : . : . :
JMSF001J17+ AGAGTTAGAACGGGCGGAAGAAGGGTTACAGTTAGAAATGGAATGATCTTCGGGCTGTGT
JMSF048F19+ AGAGTTAGAACGGGCGGAAGAAGGGTTACAGTTAGAAATGGAATGATCTTCGGGCTGTGT
JMSF003I10+ AGAGTTAGAACGGGCGGAAGAAGGGTTACAGTTAGAAATGGAATGATCTTCGGGCTGTGT
                      ____________________________________________________________
consensus AGAGTTAGAACGGGCGGAAGAAGGGTTACAGTTAGAAATGGAATGATCTTCGGGCTGTGT
 
. : . : . : . : . : . :
JMSF001J17+ GTAGCCCTGAAAATGCTTGCTTCCGAAAGATCCACGGCATGTGTTGCCCATGAAACAATC
JMSF048F19+ GTAGCCCTGAAAATGCTTGCTTCCGAAAGATCCACGGCATGTGTTGCCCATGAAACAATC
JMSF003I10+ GTAGCCCTGAAAATGCTTGCTTCCGAAAGATCCACGGCATGTGTTGCCCATGAAACAATC
                      ____________________________________________________________
consensus GTAGCCCTGAAAATGCTTGCTTCCGAAAGATCCACGGCATGTGTTGCCCATGAAACAATC
 
. : . : . : . : . : . :
JMSF001J17+ ACAAGTCCCCCTCTCAGCTCAGCAACTTCACAACTGGCAATTCTTTCGTCATCCAAGGTT
JMSF048F19+ ACAAGTCCCCCTCTCAGCTCAGCAACTTCACAACTGGCAATTCTTTCGTCATCCAAGGTT
JMSF003I10+ ACAAGTCCCCCTCTCAGCTCAGCAACTTCACAACTGGCAATTCTTTCGTCATCCAAGGTT
                      ____________________________________________________________
consensus ACAAGTCCCCCTCTCAGCTCAGCAACTTCACAACTGGCAATTCTTTCGTCATCCAAGGTT
 
. : . : . : . : . : . :
JMSF001J17+ TTGTATGAGAAGAATGAATAATTAAGCGGGGGGGATGGAAGGATCAAATCTCTGAGCATA
JMSF048F19+ TTGTATGAGAAGAATGAATAATTAAGCGGGGGGGATGGAAGGATCAAATCTCTGAGCATA
JMSF003I10+ TTGTATGAGAAGAATGAATAATTAAGCGGGGGGGATGGAAGGATCAAATCTCTGAGCATA
                      ____________________________________________________________
consensus TTGTATGAGAAGAATGAATAATTAAGCGGGGGGGATGGAAGGATCAAATCTCTGAGCATA
 
. : . : . : . : . : . :
JMSF001J17+ GAGTTCTGTTATGTGATGATCGCGCTGGAGACTGACGACGGCGAGACGGCGAGACGACGA
JMSF048F19+ GAGTTCTGTTATGTGATGATCGCGCTGGAGACTGACGACGGCGAGACGGCGAGACGACGA
JMSF003I10+ GAGTTCTGTTATGTGATGATCGCGCTGGAGACTGACGACGGCGAGACGGCGAGACGACGA
                      ____________________________________________________________
consensus GAGTTCTGTTATGTGATGATCGCGCTGGAGACTGACGACGGCGAGACGGCGAGACGACGA
 
. : . : . : . : . : . :
JMSF001J17+ CAAG
JMSF048F19+ CAAGCATGGCGAGGAGGAGGAGAGTAAATGGATGATATTTCAAAATTTCACAATTAATTC
JMSF003I10+ CAAGCATGGCGAGGAGGAGGAGAGTAAATGGATGATATTTCAAAATTTCACAATTAATTC
                      ____________________________________________________________
consensus CAAGCATGGCGAGGAGGAGGAGAGTAAATGGATGATATTTCAAAATTTCACAATTAATTC