Previous Contig 004524:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035G21Sequence584004524 (3)gb:AP004562_18416235e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P047650009864 (4)pir|F86452|F864529e-40protein F6N18.17 [imported] - Arabidopsis thaliana>gb:AE005172_892114 Arabidopsi
JMFF039I12Sequence583004524 (3)pir|F86452|F864523e-07protein F6N18.17 [imported] - Arabidopsis thaliana>gb:AE005172_892114 Arabidopsi671009864 (4)pir|F86452|F864521e-45protein F6N18.17 [imported] - Arabidopsis thaliana>gb:AE005172_892114 Arabidopsi
JMSF003I02Sequence346004524 (3)763009864 (4)gb:AP004562_18416242e-83Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF039I12+ GGAGTTCCCATTACGAAGGC
JMFF035G21+ GGAGTTCCCATTACGAAGGC
                      ____________________________________________________________
consensus GGAGTTCCCATTACGAAGGC
 
. : . : . : . : . : . :
JMFF039I12+ CGGAATTAGCCTGCTGCAATACAAAATTGTTAGCAAAGTGCCCTCCACCAGGCGGCAGCG
JMFF035G21+ CGGAATTAGCCTGCTGCAATACAAAATTGTTAGCAAAGTGCCCTCCACCAGGCGGCAGCG
                      ____________________________________________________________
consensus CGGAATTAGCCTGCTGCAATACAAAATTGTTAGCAAAGTGCCCTCCACCAGGCGGCAGCG
 
. : . : . : . : . : . :
JMFF039I12+ CCACCACTCTAAGGCTGCCGCCGATGCT-GAGAGACGGCGGCACAAACTCCTCCGCCATG
JMFF035G21+ CCACCACTCTAAGGCTGCCGCCGATGCTGGAGAGACGGCGGCACAAACTCCTCCGCCATG
                      ____________________________________________________________
consensus CCACCACTCTAAGGCTGCCGCCGATGCTGGAGAGACGGCGGCACAAACTCCTCCGCCATG
 
. : . : . : . : . : . :
JMFF039I12+ GGATTCAATTTCGAGAGCATTTCTTCCAAATCCCTCATCTCTTTCTCGCTCTTAAACCCT
JMFF035G21+ GGATTCAATTTCGAGAGCATTTCTTCCAAATCCCTCATCTCTTTCTCGCTCTTAAACCCT
                      ____________________________________________________________
consensus GGATTCAATTTCGAGAGCATTTCTTCCAAATCCCTCATCTCTTTCTCGCTCTTAAACCCT
 
. : . : . : . : . : . :
JMFF039I12+ CTCCGACCATCGCCATCCTCCTCGTCAATCTGTACATCTCTCCTCGCATCCAAACCGTTC
JMFF035G21+ CTCCGACCATCGCCATCCTCCTCGTCAATCTGTACATCTCTCCTCGCATCCAAACCGTTC
                      ____________________________________________________________
consensus CTCCGACCATCGCCATCCTCCTCGTCAATCTGTACATCTCTCCTCGCATCCAAACCGTTC
 
. : . : . : . : . : . :
JMFF039I12+ ACTTTTGACCGCTGATCGCCCAGCACTCCATTGCCATTCTGCACCGTCTGGGAACTCTGA
JMFF035G21+ ACTTTTGACCGCTGATCGCCCAGCACTCCATTGCCATTCTGCACCGTCTGGGAACTCTGA
                      ____________________________________________________________
consensus ACTTTTGACCGCTGATCGCCCAGCACTCCATTGCCATTCTGCACCGTCTGGGAACTCTGA
 
. : . : . : . : . : . :
JMFF039I12+ TCACTCTGCGCACTGCTCTTTGTTGACTGGTCACGATCGGCTGCAACGACGTCGTTCTGC
JMFF035G21+ TCACTCTGCGCACTGCTCTTTGTTGACTGGTCACGATCGGCTGCAACGACGTCGTTCTGC
                      ____________________________________________________________
consensus TCACTCTGCGCACTGCTCTTTGTTGACTGGTCACGATCGGCTGCAACGACGTCGTTCTGC
 
. : . : . : . : . : . :
JMFF039I12+ ACATTACCGTCGTTCCCATTCTCAACCACCGCCATGATTCTTCAAGAACCTATACGTAGC
JMFF035G21+ ACATTACCGTCGTTCCCATTCTCAACCACCGCCATGATTCTTCAAGAACCTATACGTAGC
JMSF003I02+ CCCATTCTCAACCACCGCCATGATTCTTCAAGAACCTATACGTAGC
                      ____________________________________________________________
consensus ACATTACCGTCGTTCCCATTCTCAACCACCGCCATGATTCTTCAAGAACCTATACGTAGC
 
. : . : . : . : . : . :
JMFF039I12+ CGGACCAAAGATTTTTCCTTTCTACTAGTATGTTCCTTTGATCCTCCTTCCCCGATATGG
JMFF035G21+ CGGACCAAAGATTTTTCCTTTCTACTAGTATGTTCCTTTGATCCTCCTTCCCCGATATGG
JMSF003I02+ CGGACCAAAGATTTTTCCTTTCTACTAGTATGTTCCTTTGATCCTCCTTCCCCGATATGG
                      ____________________________________________________________
consensus CGGACCAAAGATTTTTCCTTTCTACTAGTATGTTCCTTTGATCCTCCTTCCCCGATATGG
 
. : . : . : . : . : . :
JMFF039I12+ GTTCTGCCAAAAACTGATAGAATTTAAATGTTGTCCATTGATGAGTGATTAGAGCTGCTG
JMFF035G21+ GTTCTGCCAAAAACTGATAGAATTTAAATGTTGTCCATTGATGAGTGATTAGAGCTGCTG
JMSF003I02+ GTTCTGCCAAAAACTGATAGAATTTAAATGTTGTCCATTGATGAGTGATTAGAGCTGCTG
                      ____________________________________________________________
consensus GTTCTGCCAAAAACTGATAGAATTTAAATGTTGTCCATTGATGAGTGATTAGAGCTGCTG
 
. : . : . : . : . : . :
JMFF039I12+ AAACTCAAAGAAAGATGTGAGCTT
JMFF035G21+ AAACTCAAAGAAAGATGTGAGCTT
JMSF003I02+ AAACTCAAAGAAAGATGTGAGCTTAGGAATCAAAAGAAAATCAAATACCCAATTTCTGAT
                      ____________________________________________________________
consensus AAACTCAAAGAAAGATGTGAGCTTAGGAATCAAAAGAAAATCAAATACCCAATTTCTGAT
 
. : . : . : . : . : . :
JMSF003I02+ TTTAAAGAGTTTTGGTAGTACTATGATTTTTACTGAGTCTGCAGAGAGAAGAGATGAGTA
                      ____________________________________________________________
consensus TTTAAAGAGTTTTGGTAGTACTATGATTTTTACTGAGTCTGCAGAGAGAAGAGATGAGTA
 
. : . : . : . : . : . :
JMSF003I02+ GTTGAAGGAGAGAGAGAAAAAGGGTGGGGGTTCTTCGGATCGTCCGTTTAGGCCACTATC
                      ____________________________________________________________
consensus GTTGAAGGAGAGAGAGAAAAAGGGTGGGGGTTCTTCGGATCGTCCGTTTAGGCCACTATC