Previous Contig 004523:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034F16Sequence644004523 (3)gb:AF488592_18044392e-09Arabidopsis thaliana clone bHLH059 putative bHLH transcription factor mRNA, comp
JMSF003I01Sequence397004523 (3)758011267 (2)pir|T01090|T010901e-37hypothetical protein T10P11.13 - Arabidopsis thaliana>gb:AC002330_1530285 Arabid
JMSF007O01Sequence294004523 (3)754011267 (2)pir|T01090|T010905e-62hypothetical protein T10P11.13 - Arabidopsis thaliana>gb:AC002330_1530285 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034F16+ ATGAGGCATAGCAGGAACCGAGCTTGGCATCAGTTGGCCATGGAAACCAGGTT
                      ____________________________________________________________
consensus ATGAGGCATAGCAGGAACCGAGCTTGGCATCAGTTGGCCATGGAAACCAGGTT
 
. : . : . : . : . : . :
JMFN034F16+ TCATAGAAGAAGAAGCTCGGATATCCATCTTCATGCTCGCTGAGGACTCGTCCATCTTCA
                      ____________________________________________________________
consensus TCATAGAAGAAGAAGCTCGGATATCCATCTTCATGCTCGCTGAGGACTCGTCCATCTTCA
 
. : . : . : . : . : . :
JMFN034F16+ TAAACTCTCCTCTCCCCTGCTCCAAACTCAGCCCCAGCGGAAACGGCGCAGCGCCAGTTC
                      ____________________________________________________________
consensus TAAACTCTCCTCTCCCCTGCTCCAAACTCAGCCCCAGCGGAAACGGCGCAGCGCCAGTTC
 
. : . : . : . : . : . :
JMFN034F16+ CGTGAAAAGGTCCCCCGACCCCGCCCAGCCCCATGCCGATTCTAACACCGCCGAGGTGAG
                      ____________________________________________________________
consensus CGTGAAAAGGTCCCCCGACCCCGCCCAGCCCCATGCCGATTCTAACACCGCCGAGGTGAG
 
. : . : . : . : . : . :
JMFN034F16+ CCGAGCCGTCTCCGGAGCTTAGCTGGAGCATCATCGGAGCCGCGGCAGCCGTTCCCGCCA
JMSF003I01+ TGGAGCATCATCGGAGCCGCGGCAGCCGTTCCCGCCA
                      ____________________________________________________________
consensus CCGAGCCGTCTCCGGAGCTTAGCTGGAGCATCATCGGAGCCGCGGCAGCCGTTCCCGCCA
 
. : . : . : . : . : . :
JMFN034F16+ AGCCTCCAGCGCCGTTTCCCGCCAAATTGGCATCGGCCGCGGCATATGCCGGAAACCCTA
JMSF003I01+ AGCCTCCAGCGCCGTTTCCCGCCAAATTGGCATCGGCCGCGGCATATGCCGGAAACCCTA
                      ____________________________________________________________
consensus AGCCTCCAGCGCCGTTTCCCGCCAAATTGGCATCGGCCGCGGCATATGCCGGAAACCCTA
 
. : . : . : . : . : . :
JMFN034F16+ GGATTTGGTCGAAGAAGTCCTCGGAAGATCCGTCCGTGGGATTGTTAGACATTCCGGTGA
JMSF007O01+ GGTCGAAGAAGTCCTCGGAAGATCCGTCCGTGGGATTGTTAGACATTCCGGTGA
JMSF003I01+ GGATTTGGTCGAAGAAGTCCTCGGAAGATCCGTCCGTGGGATTGTTAGACATTCCGGTGA
                      ____________________________________________________________
consensus GGATTTGGTCGAAGAAGTCCTCGGAAGATCCGTCCGTGGGATTGTTAGACATTCCGGTGA
 
. : . : . : . : . : . :
JMFN034F16+ CTCGAACGTGCGAATGTCTCCTGGATCGACGAGTTCAACGCGACGTGTGCTCCCAAAAGC
JMSF007O01+ CTCGAACGTGCGAATGTCTCCTGGATCGACGAGTTCAACGCGACGTGTGCTCCCAAAAGC
JMSF003I01+ CTCGAACGTGCGAATGTCTCCTGGATCGACGAGTTCAACGCGACGTGTGCTCCCAAAAGC
                      ____________________________________________________________
consensus CTCGAACGTGCGAATGTCTCCTGGATCGACGAGTTCAACGCGACGTGTGCTCCCAAAAGC
 
. : . : . : . : . : . :
JMFN034F16+ ATCGACCGGTGAAGTTTAACCGCACAGTCTATGTATATATGTATATTTATATGTATATAT
JMSF007O01+ ATCGACCGGTGAAGTTTAACCGCACAGTCTATGTATATATGTATATTTATATGTATATAT
JMSF003I01+ ATCGACCGGTGAAGTTTAACCGCACAGTCTATGTATATATGTATATTTATATGTATATAT
                      ____________________________________________________________
consensus ATCGACCGGTGAAGTTTAACCGCACAGTCTATGTATATATGTATATTTATATGTATATAT
 
. : . : . : . : . : . :
JMFN034F16+ GCGCCCGCTCTATATATACATATATAGAGAGAGAGAAAGTGAGAGATATGGAGGTCTTGG
JMSF007O01+ GCGCCCGCTCTATATATACATATACAGAGAGAGAGAAAGTGAGAGATATGGAGGTCTTGG
JMSF003I01+ GCGCCCGCTCTATATATACATATATAGAGAGAGAGAAAGTGAGAGATATGGAGGTCTTGG
                      ____________________________________________________________
consensus GCGCCCGCTCTATATATACATATATAGAGAGAGAGAAAGTGAGAGATATGGAGGTCTTGG
 
. : . : . : . : . : . :
JMFN034F16+ TTTTTCGGTTTCCACAGAGCAGTGAGAGCAGGGAAGAAAGGAGAGCAAATG
JMSF007O01+ TTTTTCGGTTTCCACAGAGCAGTGAGAGCAGGGAAGAAAGGAGAGCAAATGGTGTCGC
JMSF003I01+ TTTTTCGGTTTCCACAGAGCAGTGAGAGCAGGGAAGAAAGGAGAGCAAATGGTGTCGCTC
                      ____________________________________________________________
consensus TTTTTCGGTTTCCACAGAGCAGTGAGAGCAGGGAAGAAAGGAGAGCAAATGGTGTCGCTC