Previous Contig 004516:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS027F10Sequence549004516 (5)gb:AB013389_15120604e-23Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13.
JMFS147H03Sequence587004516 (5)gb:AB013389_15120605e-23Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13.
JMSF003H06Sequence384004516 (5)sp|P14728|YAV2_XANCV0.038Hypothetical 82 kDa avirulence protein in avrBs3 region.>pir|JQ0317|JQ0317 hypot732022077gb:AY049300_15619424e-58Arabidopsis thaliana AT5g66560/K1F13_23 mRNA, complete cds.>gb:BT001071_1635326
JMSF052O19Sequence679004516 (5)gb:AY049300_15619423e-27Arabidopsis thaliana AT5g66560/K1F13_23 mRNA, complete cds.>gb:BT001071_1635326 874004516 (5)gb:AY058153_15642912e-21Arabidopsis thaliana At2g31880/F20M17.8 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052O19- ATTATCGCACCTCAAATACAAAAGAACTGTGAATCAAATTATGAACACAAA
                      ____________________________________________________________
consensus ATTATCGCACCTCAAATACAAAAGAACTGTGAATCAAATTATGAACACAAA
 
. : . : . : . : . : . :
rJMSF052O19- CTATTGCATGCAGAAGTTACTTATAGTACTTACAAAGGAATTGAATTTAAGCAAACCTAA
                      ____________________________________________________________
consensus CTATTGCATGCAGAAGTTACTTATAGTACTTACAAAGGAATTGAATTTAAGCAAACCTAA
 
. : . : . : . : . : . :
rJMSF052O19- ACCATCAATAACCAATTCAATTCACAGAATCATAGTAGGTCGAGAAGCATGTAAAAAATT
                      ____________________________________________________________
consensus ACCATCAATAACCAATTCAATTCACAGAATCATAGTAGGTCGAGAAGCATGTAAAAAATT
 
. : . : . : . : . : . :
rJMSF052O19- TTAAGGAAACGAAACAAAGTTAAGGGCATAGTTGAAACAATACAAGTAGAGCAGGACCAG
                      ____________________________________________________________
consensus TTAAGGAAACGAAACAAAGTTAAGGGCATAGTTGAAACAATACAAGTAGAGCAGGACCAG
 
. : . : . : . : . : . :
rJMSF052O19- AACCAATTAGATTAGAGCAGAAGGGCAAAAGGAAAGTAAGGGGATGGAATATTGGGTTTG
                      ____________________________________________________________
consensus AACCAATTAGATTAGAGCAGAAGGGCAAAAGGAAAGTAAGGGGATGGAATATTGGGTTTG
 
. : . : . : . : . : . :
rJMSF052O19- TAGTTAGAGGTTTTGTAGGGAGTTTATGAGAGGTGCTGTTTTCTGTGCTTTTCAAGGCAT
                      ____________________________________________________________
consensus TAGTTAGAGGTTTTGTAGGGAGTTTATGAGAGGTGCTGTTTTCTGTGCTTTTCAAGGCAT
 
. : . : . : . : . : . :
rJMSF052O19- TAATGTTTATAATCAGAGGGCGCGGGAAAGACTCGAGTTTAACAATTTTCAATCCACTGA
                      ____________________________________________________________
consensus TAATGTTTATAATCAGAGGGCGCGGGAAAGACTCGAGTTTAACAATTTTCAATCCACTGA
 
. : . : . : . : . : . :
rJMSF052O19- TTAAGAAAGCTGAGGACCTGTCTTTCTTGGAGAAAGAAGATGGATTATTGGATTGGCGTC
JMSF052O19+ GGCGTC
                      ____________________________________________________________
consensus TTAAGAAAGCTGAGGACCTGTCTTTCTTGGAGAAAGAAGATGGATTATTGGATTGGCGTC
 
. : . : . : . : . : . :
rJMSF052O19- GCTAGAGATGATTGGAAAGGGTGGATGCGGAGAAGTTTACAAAGTTGAGTTACCTGGCCT
JMSF052O19+ GCTAGAGATGATTGGAAAGGGTGGATGCGGAGAAGTTTACAAAGTTGAGTTACCTGGCCT
                      ____________________________________________________________
consensus GCTAGAGATGATTGGAAAGGGTGGATGCGGAGAAGTTTACAAAGTTGAGTTACCTGGCCT
 
. : . : . : . : . : . :
rJMSF052O19- GGAAGTAATGGGAAGTTGATTGCTATAAATTAAAGAAGATTGTGCAGCCTGCTAGCTGAT
JMSF052O19+ GGAAGTAATGGGAAGTTGATTGCTATAAATTAAAGAAGATTGTGCAGCCTGCTAGCTGAT
                      ____________________________________________________________
consensus GGAAGTAATGGGAAGTTGATTGCTATAAATTAAAGAAGATTGTGCAGCCTGCTAGCTGAT
 
. : . : . : . : . : . :
rJMSF052O19- CTGAAGAAGATAGCAGGCTTATGAATAAGAAGATGCATGCCTCAGATAAAATCAGAAATT
JMSF052O19+ CTGAAGAAGATAGCAGGCTTATGAATAAGAAGATGCATGCCTCAGATAAAATCAGAAATT
                      ____________________________________________________________
consensus CTGAAGAAGATAGCAGGCTTATGAATAAGAAGATGCATGCCTCAGATAAAATCAGAAATT
 
. : . : . : . : . : . :
rJMSF052O19- CAGATTGTGGGTTAAATCAGGCATCGAAATCTACTTCCTCTGCTAGCTCATATGCCAATA
JMSF052O19+ CAGATTGTGGGTTAAATCAGGCATCGAAATCTACTTCCTCTGCTAGCTCATATGCCAATA
                      ____________________________________________________________
consensus CAGATTGTGGGTTAAATCAGGCATCGAAATCTACTTCCTCTGCTAGCTCATATGCCAATA
 
. : . : . : . : . : . :
rJMSF052O19- CCAGACTGTCATTACCTAGTTTATGAATTCATGAAGAACGGAAGCCTACAAGATGCACTT
JMSF052O19+ CCAGACTGTCATTACCTAGTTTATGAATTCATGAAGAACGGAAGCCTACAAGATGCACTT
                      ____________________________________________________________
consensus CCAGACTGTCATTACCTAGTTTATGAATTCATGAAGAACGGAAGCCTACAAGATGCACTT
 
. : . : . : . : . : . :
rJMSF052O19- CGCCCGGGCACCGGAGCGGAGCCACGTTGGATGCCGACNAGTC-ATCTTGACGCCGTANC
JMSF052O19+ CGCCCGGGCACCGGAGCGGAGCCACGTTGGATGCCGACAAGTCAATCTTGACGCCGTAGC
                      ____________________________________________________________
consensus CGCCCGGGCACCGGAGCGGAGCCACGTTGGATGCCGACAAGTCAATCTTGACGCCGTAGC
 
. : . : . : . : . : . :
rJMSF052O19- ANAACTTGGCAGCGGCCTCAAAAGTCTCGGAACCGCCCGGAAAA
JMSF052O19+ AGAACTTGGCAGCGGCCTCAAAAGTCTCGGAACCGCCCGGAAAATTACGGAGCGAGATGT
                      ____________________________________________________________
consensus AGAACTTGGCAGCGGCCTCAAAAGTCTCGGAACCGCCCGGAAAATTACGGAGCGAGATGT
 
. : . : . : . : . : . :
JMSF052O19+ GACATTGCAGCTCCTCAACACCTTCTTCTCATATCTCTCTGTCGCCATCTGGGTTTTGGA
JMFS027F10+ GTCGCCATCTGGTTTTTGGA
JMFS147H03+ GTCGCCATCTGGTTTTTGGA
                      ____________________________________________________________
consensus GACATTGCAGCTCCTCAACACCTTCTTCTCATATCTCTCTGTCGCCATCTGGTTTTTGGA
 
. : . : . : . : . : . :
JMSF052O19+ CTCTAGCACCACTGGGTTTTGTCTCTTGCTCTGTTATCAATTCATGAAGCTTTCGACTTT
JMFS027F10+ CTCTAGCACCACTGGGTTTTGTCTCCTGCTCTGTTATCAATTCATGAAGCTTTCGACTTT
JMFS147H03+ CTCTAGCACCACTGGGTTTTGTCTCCTGCTCTGTTATCAATTCATGAAGCTTTCGACTTT
                      ____________________________________________________________
consensus CTCTAGCACCACTGGGTTTTGTCTCCTGCTCTGTTATCAATTCATGAAGCTTTCGACTTT
 
. : . : . : . : . : . :
JMSF052O19+ TCGACATCAAAGGAAACTTGTGAAGATGGAAGGTCATGTCATATGCTTCGATTATCACAT
JMFS027F10+ TCGACATCAAAGGAAACTTGTGAAGATGGAAGGTCATGTCATCTGCTTCGATTACCACAT
JMFS147H03+ TCGACATCAAAGGAAACTTGTGAAGATGGAAGGTCATGTCATCTGCTTCGATTACCACAT
                      ____________________________________________________________
consensus TCGACATCAAAGGAAACTTGTGAAGATGGAAGGTCATGTCATCTGCTTCGATTACCACAT
 
. : . : . : . : . : . :
JMSF052O19+ CGCTGGGTAACCTTGTATTGCAAAACC
JMFS027F10+ CGCTGGGCAACCCAGTAGTGCAAAACCATGCTTGCCCTTTGGAAGTGGGTTTTTCAGAGT
JMFS147H03+ CGCTGGGCAACCCAGTAGTGCAAAACCATGCTTGCCCTTTGGAAGTGGGTTTTTCAGAGT
                      ____________________________________________________________
consensus CGCTGGGCAACCCAGTAGTGCAAAACCATGCTTGCCCTTTGGAAGTGGGTTTTTCAGAGT
 
. : . : . : . : . : . :
JMFS027F10+ CCATTTTCCCGGAGCTGTAAACGGAAGAAATTAAAAGCTCAGTGCAAAAGGAGAAACTAT
JMFS147H03+ CCATTTTCCCGGAGCTGTAAACGGAAGAAATTAAAAGCTCAGTGCAAAAGGAGAAACTAT
JMSF003H06+ GCTCAGTGCAAAAGGAGAAACTAT
                      ____________________________________________________________
consensus CCATTTTCCCGGAGCTGTAAACGGAAGAAATTAAAAGCTCAGTGCAAAAGGAGAAACTAT
 
. : . : . : . : . : . :
JMFS027F10+ GCCAGATCCATGGAGTTTCGCCTTGTAGCAGCGCTCAAATAAGGAGGAGAAGCCCAGAAA
JMFS147H03+ GCCAGATCCATGGAGTTTCGCCTTGTAGCAGCGCTCAAATAAGGAGGAGAAGCCCAGAAA
JMSF003H06+ GCCAGATCCATGGAGTTTCGCCTTGTAGCAGCGCTCAAATAAGGAGGAGAAGCCCAGAAA
                      ____________________________________________________________
consensus GCCAGATCCATGGAGTTTCGCCTTGTAGCAGCGCTCAAATAAGGAGGAGAAGCCCAGAAA
 
. : . : . : . : . : . :
JMFS027F10+ AACAGAAAAAAACGGCGATGGATTTGACT-AAAATCCTCTTGACTTTACGAAAGTAGTAC
JMFS147H03+ AACAGAAAAAAACGGCGATGGATTTGACTAAAAATCCTCTTGACTTTACGAAAGTAGTAC
JMSF003H06+ AACAGAAAAAAACGGCGATGGATTTGACTAAAAATCCTCTTGACTTTACGAAAGTAGTAC
                      ____________________________________________________________
consensus AACAGAAAAAAACGGCGATGGATTTGACTAAAAATCCTCTTGACTTTACGAAAGTAGTAC
 
. : . : . : . : . : . :
JMFS027F10+ AAGATAGCAGAAGAGGTCGTCTGCAATGATTATAGCGGTTGAAAAATCACGCCAAGAAGA
JMFS147H03+ AAGATAGCAGAAGAGGTCGTCTGCAATGATTATAGCGGTTGAAAAATCACGCCAAGAAGA
JMSF003H06+ AAGATAGCAGAAGAGGTCGTCTGCAATGATTATAGCGGTTGAAAAATCACGCCAAGAAGA
                      ____________________________________________________________
consensus AAGATAGCAGAAGAGGTCGTCTGCAATGATTATAGCGGTTGAAAAATCACGCCAAGAAGA
 
. : . : . : . : . : . :
JMFS027F10+ CGAGAACAGAGAAAAACGGAGTGAAAAAAGAAAGCAATGATGAAATAAGAAGGTTTTTCT
JMFS147H03+ CGAGAACAGAGAAAAACGGAGTGAAAAAAGAAAGCAATGATGAAATAAGAAGGTTTTTCT
JMSF003H06+ CGAGAACAGAGAAAAACGGAGTGAAAAAAGAAAGCAATGATGAAATAAGAAGGTTTTTCT
                      ____________________________________________________________
consensus CGAGAACAGAGAAAAACGGAGTGAAAAAAGAAAGCAATGATGAAATAAGAAGGTTTTTCT
 
. : . : . : . : . : . :
JMFS027F10+ TTTCCCTTCCCTTCTTTTGCCCCTCTCTCTCTCTTTCT
JMFS147H03+ TTTCCCTTCCCTTCTTTTGCCCCTCTCTCTCTCTTTCTTTCTTTATTTCTTTCTCTCACT
JMSF003H06+ TTTCCCTTCCCTTCTTTTGCCCCTCTCTCTCTCTTTCTTTCTTTATTTCTTTCTCTCACT
                      ____________________________________________________________
consensus TTTCCCTTCCCTTCTTTTGCCCCTCTCTCTCTCTTTCTTTCTTTATTTCTTTCTCTCACT
 
. : . : . : . : . : . :
JMFS147H03+ GTGCAGCGCTGTGTG
JMSF003H06+ GTGCAGCGCTGTGTGGGGGCGGAGTTTCAAGAAGAGGAGAGAGAAAGAGTGGAGGGTTCC
                      ____________________________________________________________
consensus GTGCAGCGCTGTGTGGGGGCGGAGTTTCAAGAAGAGGAGAGAGAAAGAGTGGAGGGTTCC