Previous Contig 004499:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN010C14Sequence625004499 (3)pir|T02514|T025146e-68hypothetical protein At2g38310 [imported] - Arabidopsis thaliana>gb:AC004683_153
JMSF003E21Sequence372004499 (3)pir|T02514|T025144e-28hypothetical protein At2g38310 [imported] - Arabidopsis thaliana>gb:AC004683_153714004499 (3)pir|T02514|T025147e-68hypothetical protein At2g38310 [imported] - Arabidopsis thaliana>gb:AC004683_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003E21- GATCAATTCACAA
                      ____________________________________________________________
consensus GATCAATTCACAA
 
. : . : . : . : . : . :
rJMSF003E21- GTTATCATACCATCCAAAATATCTCAACAAATTAAATCATAGAACTCACAATGCCTAGCA
                      ____________________________________________________________
consensus GTTATCATACCATCCAAAATATCTCAACAAATTAAATCATAGAACTCACAATGCCTAGCA
 
. : . : . : . : . : . :
rJMSF003E21- GCTAAGATCTGGATCCAGATAATCAATGTTGACATTTTCATATTAGATCTTGTTCTAACA
JMFN010C14+ TAACA
                      ____________________________________________________________
consensus GCTAAGATCTGGATCCAGATAATCAATGTTGACATTTTCATATTAGATCTTGTTCTAACA
 
. : . : . : . : . : . :
rJMSF003E21- ACATCAGTTGTTGTTGTTTCGCCGGCAGGAATTCTGGGCGATCTGCGCCAGAGATTGGAG
JMFN010C14+ ACATCAGTTGTTGTTGTTTCGCCGGCAGGAATTCTGGGCGATCTGCGCCAGAGATTGGAG
                      ____________________________________________________________
consensus ACATCAGTTGTTGTTGTTTCGCCGGCAGGAATTCTGGGCGATCTGCGCCAGAGATTGGAG
 
. : . : . : . : . : . :
rJMSF003E21- GTTGCATTTGACGATAGTGTCGACGAAGACGCAGGTTTCGTCTCTCGTGTTTCCCGGCGG
JMFN010C14+ GTTGCATTTGACGATAGTGTCGACGAAGACGCAGGTTTCGTCTCTCGTGTTTCCCGGCGG
                      ____________________________________________________________
consensus GTTGCATTTGACGATAGTGTCGACGAAGACGCAGGTTTCGTCTCTCGTGTTTCCCGGCGG
 
. : . : . : . : . : . :
rJMSF003E21- GACGTCAACAACGTAGGACTCCACGACGATGGTGGTGCCGCCGGTGGCCTCGGAGTGGAG
JMFN010C14+ GACGTCAACAACGTAGGACTCCACGACGATGGTGGTGCCGCCGGTGGCCTCGGAGTGGAG
                      ____________________________________________________________
consensus GACGTCAACAACGTAGGACTCCACGACGATGGTGGTGCCGCCGGTGGCCTCGGAGTGGAG
 
. : . : . : . : . : . :
rJMSF003E21- GGTGGTGACGGAGCGGTAGTTGGCGAGGCGGTGGTCGCCGGCGACGACGCTGAAGCTGAT
JMFN010C14+ GGTGGTGACGGAGCGGTAGTTGGCGAGGCGGTGGTCGCCGGCGACGACGCTGAAGCTGAT
                      ____________________________________________________________
consensus GGTGGTGACGGAGCGGTAGTTGGCGAGGCGGTGGTCGCCGGCGACGACGCTGAAGCTGAT
 
. : . : . : . : . : . :
rJMSF003E21- GACGTGGCGCTCCTCGTCGAGGATCTCCAGCCGCTCGGTGCTGCTGCCGGCGGGGAGGCC
JMFN010C14+ GACGTGGCGCTCCTCGTCGAGGATCTCCAGCCGCTCGGTGCTGCTGCCGGCGGGGAGGCC
JMSF003E21+ GGGAGGCC
                      ____________________________________________________________
consensus GACGTGGCGCTCCTCGTCGAGGATCTCCAGCCGCTCGGTGCTGCTGCCGGCGGGGAGGCC
 
. : . : . : . : . : . :
rJMSF003E21- GGAGATGACGCGGACCTCGCGGAGGGTGCCCACGGTGCCGTCTCCGACGATGACGTCGCA
JMFN010C14+ GGAGATGACGCGGACCTCGCGGAGGGTGCCCACGGTGCCGTCTCCGACGATGACGTCGCA
JMSF003E21+ GGAGATGACGCGGACCTCGCGGAGGGTGCCCACGGTGCCGTCTCCGACGATGACGTCGCA
                      ____________________________________________________________
consensus GGAGATGACGCGGACCTCGCGGAGGGTGCCCACGGTGCCGTCTCCGACGATGACGTCGCA
 
. : . : . : . : . : . :
rJMSF003E21- GCTCTTCACGAAGTGCTTGTAGGCCTGGGGGTTGTCGAAGCGGCGGACGACGGACCAAAC
JMFN010C14+ GCTCTTCACGAAGTGCTTGTAGGCCTGGGGGTTGTCGAAGCGGCGGACGACGGACCAAAC
JMSF003E21+ GCTCTTCACGAAGTGCTTGTAGGCCTGGGGGTTGTCGAAGCGGCGGACGACGGACCAAAC
                      ____________________________________________________________
consensus GCTCTTCACGAAGTGCTTGTAGGCCTGGGGGTTGTCGAAGCGGCGGACGACGGACCAAAC
 
. : . : . : . : . : . :
rJMSF003E21- GGTGGAGGCGGGGGCGGAGATCCGCTGGATCACGGCGGAGCAGCACTGGTTGGGTCCTAC
JMFN010C14+ GGTGGAGGCGGGGGCGGAGATCCGCTGGATCACGGCGGAGCAGCACTGGTTGGGTCCTAC
JMSF003E21+ GGTGGAGGCGGGGGCGGAGATCCGCTGGATCACGGCGGAGCAGCACTGGTTGGGTCCTAC
                      ____________________________________________________________
consensus GGTGGAGGCGGGGGCGGAGATCCGCTGGATCACGGCGGAGCAGCACTGGTTGGGTCCTAC
 
. : . : . : . : . : . :
rJMSF003E21- CGGATGGGTGTGATAGCGGGCCACCGTTTCCGGGACCTCTGTGACTGTGGCGCAAGATAT
JMFN010C14+ CGGATGGGTGTGATAGCGGGCCACCGTTTCCGGGACCTCTGTGACTGTGGCGCAAGATAT
JMSF003E21+ CGGATGGGTGTGATAGCGGGCCACCGTTTCCGGGACCTCTGTGACTGTGGCGCAAGATAT
                      ____________________________________________________________
consensus CGGATGGGTGTGATAGCGGGCCACCGTTTCCGGGACCTCTGTGACTGTGGCGCAAGATAT
 
. : . : . : . : . : . :
rJMSF003E21- TGGCGATGACAGCCGTTGATGCGGCGGCTGAGATTGCTTAC
JMFN010C14+ TGGCGATGACAGCCGTTGATGCGGCGGCTGAGATTGCTTACGAGTGGTGGAGGTGGCGGT
JMSF003E21+ TGGCGATGACAGCCGTTGATGCGGCGGCTGAGATTGCTTACGAGTGGTGGAGGTGGCGGT
                      ____________________________________________________________
consensus TGGCGATGACAGCCGTTGATGCGGCGGCTGAGATTGCTTACGAGTGGTGGAGGTGGCGGT
 
. : . : . : . : . : . :
JMFN010C14+ GCTGATTATTTGAAGTAGAA
JMSF003E21+ GCTGATTCTTTGAAGTAGAACAGAAGTCTTTGGTGGGTTCGGAGCCATTTTGTTTTCAGC
                      ____________________________________________________________
consensus GCTGATTCTTTGAAGTAGAACAGAAGTCTTTGGTGGGTTCGGAGCCATTTTGTTTTCAGC