Previous Contig 004493:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS007G01Sequence374004493 (7)gb:AY139797_15824020.041Arabidopsis thaliana At1g02660/T14P4_9 mRNA, complete cds.
JMFS044F10Sequence504004493 (7)gb:AY139797_15824021e-10Arabidopsis thaliana At1g02660/T14P4_9 mRNA, complete cds.
JMFS135G06Sequence678004493 (7)
JMFS144B03Sequence626004493 (7)
JMSF003D22Sequence362004493 (7)656012206 (3)pir|F86156|F861562e-22hypothetical protein T14P4.6 - Arabidopsis thaliana>gb:AE005172_889287 Arabidops
JMSF019H16Sequence501004493 (7)768012206 (3)pir|F86156|F861562e-37hypothetical protein T14P4.6 - Arabidopsis thaliana>gb:AE005172_889287 Arabidops
JMSF021J06Sequence660004493 (7)768012206 (3)pir|F86156|F861569e-22hypothetical protein T14P4.6 - Arabidopsis thaliana>gb:AE005172_889287 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS044F10+ CTATATGGTATACAGCAGATGCACTTTTTCTATTTCCACTGCTCTTATCGGATTCATTT
                      ____________________________________________________________
consensus CTATATGGTATACAGCAGATGCACTTTTTCTATTTCCACTGCTCTTATCGGATTCATTT
 
. : . : . : . : . : . :
JMFS044F10+ TCTTTCAGATTCACTGCATCCCTCTCAGTTTCATTTGTTTGAGCAACTTCATTCTCTTTT
                      ____________________________________________________________
consensus TCTTTCAGATTCACTGCATCCCTCTCAGTTTCATTTGTTTGAGCAACTTCATTCTCTTTT
 
. : . : . : . : . : . :
JMFS044F10+ CTCAGCTGGTCTTCCACCAATGCCCTTTCTTTCTCAGCTTTCAGTGCATGATGTTTCTTC
                      ____________________________________________________________
consensus CTCAGCTGGTCTTCCACCAATGCCCTTTCTTTCTCAGCTTTCAGTGCATGATGTTTCTTC
 
. : . : . : . : . : . :
JMFS044F10+ TCCAATGATGAGGTGATGAAGCGTAATCGCTGGCGTCTTAAAAGATTCTCAGGCTTGATC
                      ____________________________________________________________
consensus TCCAATGATGAGGTGATGAAGCGTAATCGCTGGCGTCTTAAAAGATTCTCAGGCTTGATC
 
. : . : . : . : . : . :
JMFS044F10+ TGGGATATGGAATAAGCCAAACTTCCCAGATGATGCCATCTGAGCATATAATCTAGCCTC
                      ____________________________________________________________
consensus TGGGATATGGAATAAGCCAAACTTCCCAGATGATGCCATCTGAGCATATAATCTAGCCTC
 
. : . : . : . : . : . :
JMFS044F10+ CGCTAGTGACACCCGTCGTAGAAGTTTGGAAAATGAATCTCTGTCGAATTCTATATTGCC
JMFS007G01+ AGTTTGGAAAATGAATCTCTGTCGAATTCTATATTGCC
                      ____________________________________________________________
consensus CGCTAGTGACACCCGTCGTAGAAGTTTGGAAAATGAATCTCTGTCGAATTCTATATTGCC
 
. : . : . : . : . : . :
JMFS044F10+ GTCGTCATCATCAACAGCGCAGACATCGCAGTCACCATCATCAGCTCCAATACATGAATC
JMFS007G01+ GTCGTCATCATCAACAGCGCAGACATCGCAGTCACCATCATCAGCTCCAATACATGAATC
JMFS144B03+ GTCACCATCATCAGCTCCAATACATGAATC
JMFS135G06+ ACATGAATC
                      ____________________________________________________________
consensus GTCGTCATCATCAACAGCGCAGACATCGCAGTCACCATCATCAGCTCCAATACATGAATC
 
. : . : . : . : . : . :
JMFS044F10+ GTTGTCCTCTGAAACACCAATTCTGTCTTCCGATCCGTCAGCTTTTGCTTCTTCATCTTC
JMFS007G01+ GTTGTCCTCTGAAACACCAATTCTGTCTTCCGATCCGTCAGCTTTTGCTTCTTCATCTTC
JMFS144B03+ GTTGTCCTCTGAAACACCAATTCTGTCTTCCGATCCGTCAGCTTTTGCTTCTTCATCTTC
JMSF021J06+ TGAAACACCAATTCTGTCTTCCGATCCGTCAGCTTTTGCTTCTTCATCTTC
JMFS135G06+ GTTGTCCTCTGAACANCCAATTCTGTCTTCCGATCCGTCAGCTTTTGCTTCTTCATCTTC
                      ____________________________________________________________
consensus GTTGTCCTCTGAAACACCAATTCTGTCTTCCGATCCGTCAGCTTTTGCTTCTTCATCTTC
 
. : . : . : . : . : . :
JMFS044F10+ ATCTTCATCTTCTTCTTGTTGTTCC
JMFS007G01+ ATCTTCATCTTCTTCTTGTTGTTCCTTGCGCAGAGATCGCACGCGGAGGATCTTCATGAC
JMFS144B03+ ATCTTCATCTTCTTCTTGTTGTTCCTTGCGCAGAGATCGCACGCGGAGGATCTTCATGAC
JMSF021J06+ ATCTTCATCTTCTTCTTGTTGTTCCTTGCGCAGAGATCGCACGCGGAGGATCTTCATGAC
JMFS135G06+ ATCTTCATCTTCTTCTTGTTGTTCCTTGCGCAGAGATCGCACGCGGAGGATCTTCATGAC
                      ____________________________________________________________
consensus ATCTTCATCTTCTTCTTGTTGTTCCTTGCGCAGAGATCGCACGCGGAGGATCTTCATGAC
 
. : . : . : . : . : . :
JMFS007G01+ CCAATTGACATTCTGCTCCTCCGCGTCTTCCTTATCGTCAACCAAAATGGGGGGGCCGTC
JMFS144B03+ CCAATTGACATTCTGCTCCTCCGCGTCTTCCTTATCGTCAACCAAAATGGGGGGGCCGTC
JMSF021J06+ CCAATTGACATTCTGCTCCTCCGCGTCTTCCTTATCGTCAACCAAAATGGGGGGGCCGTC
JMSF019H16+ GTCAACCAAAATGGGGGGGCCGTC
JMFS135G06+ CCAATTGACATTCTGCTCCTCCGCGTCTTCCTTATCGTCAACCAAAATGGGGGGGCCGTC
                      ____________________________________________________________
consensus CCAATTGACATTCTGCTCCTCCGCGTCTTCCTTATCGTCAACCAAAATGGGGGGGCCGTC
 
. : . : . : . : . : . :
JMFS007G01+ CACCGCAACGGCGTCGAAGCGGTTTCTACTCCCGGGCCACAGAGATCTAAGCGGATGCCG
JMFS144B03+ CACCGCAACGGCGTCGAAGCGGTTTCTACTCCCGGGCCACAGAGATCTAAGCGGATGCCG
JMSF021J06+ CACCGCAACGGCGTCGAAGCGGTTTCTACTCCCGGGCCACAGAGATCTAAGCGGATGCCG
JMSF019H16+ CACCGCAACGGCGTCGAAGCGGTTTCTACTCCCGGGCCACAGAGATCTAAGCGGATGCCG
JMFS135G06+ CACCGCAACGGCGTCGAAGCGGTTTCTACTCCCGGGCCACAGAGATCTAAGCGGATGCCG
                      ____________________________________________________________
consensus CACCGCAACGGCGTCGAAGCGGTTTCTACTCCCGGGCCACAGAGATCTAAGCGGATGCCG
 
. : . : . : . : . : . :
JMFS007G01+ GAAAGAGAAACCCCAAGGAGGAGGCGAGGGCTTGTC
JMFS144B03+ GAAAGAGAAACCCCAAGGAGGAGGCGAGGGCTTGTCCACAGACAAGGCCGCCGAAGGGCG
JMSF021J06+ GAAAGAGAAACCCCAAGGAGGAGGCGAGGGCTTGTCCACAGACAAGGCCGCCGAAGGGCG
JMSF019H16+ GAAAGAGAAACCCCAAGGAGGAGGCGAGGGCTTGTCCACAGACAAGGCCGCCGAAGGGCG
JMFS135G06+ GAAAGAGAAACCCCAAGGAGGAGGCGAGGGCTTGTCCACAGACAAGGCCGCCGAAGGGCG
                      ____________________________________________________________
consensus GAAAGAGAAACCCCAAGGAGGAGGCGAGGGCTTGTCCACAGACAAGGCCGCCGAAGGGCG
 
. : . : . : . : . : . :
JMFS144B03+ TCCAACAGCAGAGGGAGTAATATGGGATGTTGAATTATGACTCATACGGAAATCCAATCC
JMSF021J06+ TCCAACAGCAGAGGGAGTAATATGGGATGTTGAATTATGACTCATACGGAAATCCAATCC
JMSF019H16+ TCCAACAGCAGAGGGAGTAATATGGGATGTTGAATTATGACTCATACGGAAATCCAATCC
JMFS135G06+ TCCAACAGCAGAGGGAGTAATATGGGATGTTGAATTATGACTCATACGGAAATCCAATCC
JMSF003D22+ CC
                      ____________________________________________________________
consensus TCCAACAGCAGAGGGAGTAATATGGGATGTTGAATTATGACTCATACGGAAATCCAATCC
 
. : . : . : . : . : . :
JMFS144B03+ AGCGGCGCCGACGGCGGCGATAGGCGTTGCTATTCCCGGAATCCCTGCCTTCAAGCAGAG
JMSF021J06+ AGCGGCGCCGACGGCGGCGATAGGCGTTGCTATTCCCGGAATCCCTGCCTTCAAGCAGAG
JMSF019H16+ AGCGGCGCCGACGGCGGCGATAGGCGTTGCTATTCCCGGAATCCCTGCCTTCAAGCAGAG
JMFS135G06+ AGCGGCGCCGACGGCGGCGATAGGCGTTGCTATTCCCGGAATCCCTGCCTTCAAGCAGAG
JMSF003D22+ AGCGGCGCCGACGGCGGCGATAGGCGTTGCTATTCCCGGAATCCCTGCCTTCAAGCAGAG
                      ____________________________________________________________
consensus AGCGGCGCCGACGGCGGCGATAGGCGTTGCTATTCCCGGAATCCCTGCCTTCAAGCAGAG
 
. : . : . : . : . : . :
JMFS144B03+ ACTATCCATCGACAACAGCTCAAGTTATAATAATAATCTGAATTTGAGCTACCTAGATTA
JMSF021J06+ ACTATCCATCGACAACAGCTCAAGTTATAATAATAATCTGAATTTGAGCTACCTAGATTA
JMSF019H16+ ACTATCCATCGACAACAGCTCAAGTTATAATAATAATCTGAATTTGAGCTACCTAGATTA
JMFS135G06+ ACTATCCATCGACAACAGCTCAAGTTATAATAATAATCTGAATTTGAGCTACCTAGATTA
JMSF003D22+ ACTATCCATCGACAACAGCTCAAGTTATAATAATAATCTGAATTTGAGCTACCTAGATTA
                      ____________________________________________________________
consensus ACTATCCATCGACAACAGCTCAAGTTATAATAATAATCTGAATTTGAGCTACCTAGATTA
 
. : . : . : . : . : . :
JMFS144B03+ GATTTTATAATTTGCCTCTCGATCAATTCCTTGTTGTTGTTGGGATATAAAGAGGTGAAG
JMSF021J06+ GATTTTATAATTTGCCTCTCGATCAATTCCTTGTTGTTGTTGGGATATAAAGAGGTGAAG
JMSF019H16+ GATTTTATAATTTGCCTCTCGATCAATTCCTTGTTGTTGTTGGGATATAAAGAGGTGAAG
JMFS135G06+ GATTTTATAATTTGCCTCTCGATCAATTCCTTGTTGTTGTTGGGATATAAAGAGGTGAAG
JMSF003D22+ GATTTTATAATTTGCCTCTCGATCAATTCCTTGTTGTTGTTGGGATATAAAGAGGTGAAG
                      ____________________________________________________________
consensus GATTTTATAATTTGCCTCTCGATCAATTCCTTGTTGTTGTTGGGATATAAAGAGGTGAAG
 
. : . : . : . : . : . :
JMFS144B03+ GTGGGCATGCAATGCGAGGAAAGCGAGGAGTTAAGGTTCACCACAATCTGTGAATT
JMSF021J06+ GTGGGCATGCAATGCGAGGAAAGCGAGGAGTTAAGGTTCACCACAATCTGTGAATTTAGG
JMSF019H16+ GTGGGCATGCAATGCGAGGAAAGCGAGGAGTTAAGGTTCACCACAATCTGTGAATTTAGG
JMFS135G06+ GTGGGCATGCAATGCGAGGAAAGCGAGGAGTTAAGGTTCACCACAATCTGTGAATTTAGG
JMSF003D22+ GTGGGCATGCAATGCGAGGAAAGCGAGGAGTTAAGGTTCACCACAATCTGTGAATTTAGG
                      ____________________________________________________________
consensus GTGGGCATGCAATGCGAGGAAAGCGAGGAGTTAAGGTTCACCACAATCTGTGAATTTAGG
 
. : . : . : . : . : . :
JMSF021J06+ AGAGCTTCTTCTTGACTTGTACTACCAACAATGCTCCAGAGGAATACCTAGCTGGCGC
JMSF019H16+ AGAGCTTCTTCTTGACTTGTACTACCAACAATGCTCCAGAGGAATACCTAGCTGGC
JMFS135G06+ AGAGCTTCTTCTTGACTTGTACTACCAACAATGCTCCAGAGGAATACCTAGCTGGCGC
JMSF003D22+ AGAGCTTCTTCTTGACTTGTACTACCAACAATGCTCCAGAGGAATACCTAGCTGGCGCTG
                      ____________________________________________________________
consensus AGAGCTTCTTCTTGACTTGTACTACCAACAATGCTCCAGAGGAATACCTAGCTGGCGCTG
 
. : . : . : . : . : . :
JMSF003D22+ CAAAATGTAGAGGACAGGTTTCTTCTCCAGAGTTTTAAAGCAAACAGGTCACCAACCGCC
                      ____________________________________________________________
consensus CAAAATGTAGAGGACAGGTTTCTTCTCCAGAGTTTTAAAGCAAACAGGTCACCAACCGCC