Previous Contig 004491:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003D18Sequence308004491 (3)470011303 (2)gb:AY647238_16198675e-15Zea mays unknown mRNA.
JMSF004H03Sequence356004491 (3)306011303 (2)
JMSF038O08Sequence695004491 (3)920023827gb:AP005295_18500463e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ16

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038O08+ CAGGTGATGGAGATTCAATACCCCCATGGGATGGAGTGCTAAATTGAGTGGACACAGCAC
                      ____________________________________________________________
consensus CAGGTGATGGAGATTCAATACCCCCATGGGATGGAGTGCTAAATTGAGTGGACACAGCAC
 
. : . : . : . : . : . :
JMSF038O08+ AAATCAGTGACCCATCATCATCCCTTGTACTAGCTGTTTCAGAGTTATCCGCATTTTCCA
                      ____________________________________________________________
consensus AAATCAGTGACCCATCATCATCCCTTGTACTAGCTGTTTCAGAGTTATCCGCATTTTCCA
 
. : . : . : . : . : . :
JMSF038O08+ TTCTATATAGAGAGATTGGAAAGGGTTGATCCCCTGGGGCAGTATGAGTAGTTTCACTAC
                      ____________________________________________________________
consensus TTCTATATAGAGAGATTGGAAAGGGTTGATCCCCTGGGGCAGTATGAGTAGTTTCACTAC
 
. : . : . : . : . : . :
JMSF038O08+ GAATACTATTGGGAGCTACTTCCTTATTCTCAGAAAAGCTTCGTCCTGTATCACTGGCAT
                      ____________________________________________________________
consensus GAATACTATTGGGAGCTACTTCCTTATTCTCAGAAAAGCTTCGTCCTGTATCACTGGCAT
 
. : . : . : . : . : . :
JMSF038O08+ TGACATTGCTTGGACCATCTACCACATTGCCAGCAGATGAAACTCCACTTTCAATTTTAG
                      ____________________________________________________________
consensus TGACATTGCTTGGACCATCTACCACATTGCCAGCAGATGAAACTCCACTTTCAATTTTAG
 
. : . : . : . : . : . :
JMSF004H03+ TTAAGCTTTTTTGGCCTAATGT
JMSF038O08+ AGCAAGTAAAGGAAGCACCAGAACGCCTCCTTGGGGCCTTAAGCTTTTTTGGCCTAATGT
                      ____________________________________________________________
consensus AGCAAGTAAAGGAAGCACCAGAACGCCTCCTTGGGGCCTTAAGCTTTTTTGGCCTAATGT
 
. : . : . : . : . : . :
JMSF004H03+ GTTTTGCAGAATTGACCAGCAAATGATCTTCTATCTGATCATGGGGCGAGTCGGAAGGAG
JMSF038O08+ GTTTTGCAGAATTGACCAGCAAATGATCTTCTATCTGATCATGGGGCGAGTCGGAAGGAG
JMSF003D18+ AAGGAG
                      ____________________________________________________________
consensus GTTTTGCAGAATTGACCAGCAAATGATCTTCTATCTGATCATGGGGCGAGTCGGAAGGAG
 
. : . : . : . : . : . :
JMSF004H03+ AAGCACCGCAGATTAAAAGAGAAGAGAGGGTTCGTTTGACGCTGCGGTTGCGGGAGGGGC
JMSF038O08+ AAGCACCGCAGATTAAAAGAGAAGAGAGGGTTCGTTTGACGCTGCGGTTGCGGGAGGGGC
JMSF003D18+ AAGCACCGCAGATTAAAAGAGAAGAGAGGGTTCGTTTGACGCTGCGGTTGCGGGAGGGGC
                      ____________________________________________________________
consensus AAGCACCGCAGATTAAAAGAGAAGAGAGGGTTCGTTTGACGCTGCGGTTGCGGGAGGGGC
 
. : . : . : . : . : . :
JMSF004H03+ GATGGGGTCGCGAACCCAGACGGCTACCGCCGGAACCCATCGGACCCAAGAAGCCCCTCC
JMSF038O08+ GATGGGGTCGCGAACCCAGACGGCTACCGCCGGAACCCATCGGACCCAAGAAGCCCCTCC
JMSF003D18+ GATGGGGTCGCGAACCCAGACGGCTACCGCCGGAACCCATCGGACCCAAGAAGCCCCTCC
                      ____________________________________________________________
consensus GATGGGGTCGCGAACCCAGACGGCTACCGCCGGAACCCATCGGACCCAAGAAGCCCCTCC
 
. : . : . : . : . : . :
JMSF004H03+ TCCGTTTCCGTGATCTCTTCCTCTTCCTTCAAGGGAGAGCGATTGGTGGGAGAGGTGAAG
JMSF038O08+ TCCGTTTCCGTGATCTCTTCCTCTTCCTTCAAGGGAGAGCGATTGGTGGGAGAGGTGAAG
JMSF003D18+ TCCGTTTCCGTGATCTCTTCCTCTTCCTTCAAGGGAGAGCGATTGGTGGGAGAGGTGAAG
                      ____________________________________________________________
consensus TCCGTTTCCGTGATCTCTTCCTCTTCCTTCAAGGGAGAGCGATTGGTGGGAGAGGTGAAG
 
. : . : . : . : . : . :
JMSF004H03+ GGGAAGAGGAAAGGAATGGTGATTATGTGAAAATGAGAGAGAGTGCCGCGTGGTGTGAAC
JMSF038O08+ GGGAAGAGGAAAGGAATGGTGATTATGTGAAAATGAGAGAGAGTGCCGCGTGGTGTGAAC
JMSF003D18+ GGGAAGAGGAAAGGAATGGTGATTATGTGAAAATGAGAGAGAGTGCCGCGTGGTGTGAAC
                      ____________________________________________________________
consensus GGGAAGAGGAAAGGAATGGTGATTATGTGAAAATGAGAGAGAGTGCCGCGTGGTGTGAAC
 
. : . : . : . : . : . :
JMSF004H03+ CACACAGCTCACAGGTGAGGTGAGATGTCGCCC
JMSF038O08+ CACACAGCTCACAGGTGAGGTGAGATGTCGCCC
JMSF003D18+ CACACAGCTCACAGGTGAGGTGAGATGTCGCCCAGTGAATCAGCTGCTTTTGCGTTCCTC
                      ____________________________________________________________
consensus CACACAGCTCACAGGTGAGGTGAGATGTCGCCCAGTGAATCAGCTGCTTTTGCGTTCCTC