Previous Contig 004488:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS043E06Sequence642004488 (2)gb:AY059784_15646325e-93Arabidopsis thaliana putative WD-repeat membrane protein (At4g04940) mRNA, compl
JMSF003D09Sequence278004488 (2)gb:AY059784_15646328e-22Arabidopsis thaliana putative WD-repeat membrane protein (At4g04940) mRNA, compl728022061gb:AP003568_18309691e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P001

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS043E06+ GACATGAATTTT
                      ____________________________________________________________
consensus GACATGAATTTT
 
. : . : . : . : . : . :
JMFS043E06+ CCCATCAGTGCATCCCACAGCAACAACATCTAGTGCTGGCGATGATATACAGCAATTTAT
                      ____________________________________________________________
consensus CCCATCAGTGCATCCCACAGCAACAACATCTAGTGCTGGCGATGATATACAGCAATTTAT
 
. : . : . : . : . : . :
JMFS043E06+ AGAAGACTTCCACCTATTGAACTCATATACTTTTTTCTTTGTGCTAATGTTCCAAAGTTG
                      ____________________________________________________________
consensus AGAAGACTTCCACCTATTGAACTCATATACTTTTTTCTTTGTGCTAATGTTCCAAAGTTG
 
. : . : . : . : . : . :
JMFS043E06+ CAGAGTACCTTCTTGACTTCCAACAATAACCTTGTTTAAATAAGTATCTGGATGCATTAT
                      ____________________________________________________________
consensus CAGAGTACCTTCTTGACTTCCAACAATAACCTTGTTTAAATAAGTATCTGGATGCATTAT
 
. : . : . : . : . : . :
JMFS043E06+ GCAGCTAGGTGTGAATGTGCCGTCTAGCAACATGTGTCCAACTGGAGCAACGTTCTCATC
                      ____________________________________________________________
consensus GCAGCTAGGTGTGAATGTGCCGTCTAGCAACATGTGTCCAACTGGAGCAACGTTCTCATC
 
. : . : . : . : . : . :
JMFS043E06+ TATTCCTTTGAAGTTCCATGTGTAGATATTACCTTCAACATCAACACTTAAGATGTGGTC
                      ____________________________________________________________
consensus TATTCCTTTGAAGTTCCATGTGTAGATATTACCTTCAACATCAACACTTAAGATGTGGTC
 
. : . : . : . : . : . :
JMFS043E06+ ACCGAAAAGTAGCAAGTGGTTAACCTTAGCGCTATGCTTGCTCCAAGTAGCCACCTGATG
                      ____________________________________________________________
consensus ACCGAAAAGTAGCAAGTGGTTAACCTTAGCGCTATGCTTGCTCCAAGTAGCCACCTGATG
 
. : . : . : . : . : . :
JMFS043E06+ AGCACGCTTGACAACTGCAATGTCATTTCCATAGGCAGCAAATGTGTAGTCACGGTAAGA
                      ____________________________________________________________
consensus AGCACGCTTGACAACTGCAATGTCATTTCCATAGGCAGCAAATGTGTAGTCACGGTAAGA
 
. : . : . : . : . : . :
JMFS043E06+ AGCAAGAGCTCGTATCTTCTTTGGTAGTTGAGGGCCAACGAGAACCAAATTGAGCTTGGC
JMSF003D09+ GGTAGTTGAGGGCCAACGAGAACCAAATTGAGCTTGGC
                      ____________________________________________________________
consensus AGCAAGAGCTCGTATCTTCTTTGGTAGTTGAGGGCCAACGAGAACCAAATTGAGCTTGGC
 
. : . : . : . : . : . :
JMFS043E06+ GCAGTTGTAAATCTGGAAAGCTTTGCCGATGCTGACGGTGACGAAGGTCTCGGTGCCGAG
JMSF003D09+ GCAGTTGTAAATCTGGAAAGCTTTGCCGATGCTGACGGTGACGAAGGTCTCGGTGCCGAG
                      ____________________________________________________________
consensus GCAGTTGTAAATCTGGAAAGCTTTGCCGATGCTGACGGTGACGAAGGTCTCGGTGCCGAG
 
. : . : . : . : . : . :
JMFS043E06+ TCTCTGTACAGAGATGGGGACGTTGCTCGTAATATATCCAATTGCTCTGAATGGTTCGAA
JMSF003D09+ TCTCTGTACAGAGATGGGGACGTTGCTCGTAATATATCCAATTGCTCTGAATGGTTCGAA
                      ____________________________________________________________
consensus TCTCTGTACAGAGATGGGGACGTTGCTCGTAATATATCCAATTGCTCTGAATGGTTCGAA
 
. : . : . : . : . : . :
JMFS043E06+ AATCCCCATTCTTGTTGAGCTTCGTTCTGC
JMSF003D09+ AATCCCCATTCTTGTTGAGCTTCGTTCTGCTACAACAACAACCAGAAGGAGAACAGAAGG
                      ____________________________________________________________
consensus AATCCCCATTCTTGTTGAGCTTCGTTCTGCTACAACAACAACCAGAAGGAGAACAGAAGG
 
. : . : . : . : . : . :
JMSF003D09+ AAAAGAAGGAGAGAATGGCGTCCGCATCCAGGGTTTAGGGTTTTGGTAGAGGGGAGAATC
                      ____________________________________________________________
consensus AAAAGAAGGAGAGAATGGCGTCCGCATCCAGGGTTTAGGGTTTTGGTAGAGGGGAGAATC