Previous Contig 004479:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN030N13Sequence634004479 (14)gb:AY084384_15694745e-29Arabidopsis thaliana clone 106301 mRNA, complete sequence.
JMFN041L20Sequence549004479 (14)pir|T51442|T514421e-27seed maturation-like protein - Arabidopsis thaliana>gb:ATF2G14_1550445 Arabidops
JMSF003C03Sequence339004479 (14)777004479 (14)pir|T51442|T514424e-64seed maturation-like protein - Arabidopsis thaliana>gb:ATF2G14_1550445 Arabidops
JMSF007G10Sequence422004479 (14)gb:AY084384_15694743e-17Arabidopsis thaliana clone 106301 mRNA, complete sequence.741012818 (2)pir|T51442|T514426e-31seed maturation-like protein - Arabidopsis thaliana>gb:ATF2G14_1550445 Arabidops
JMSF017D18Sequence519004479 (14)gb:AY084384_15694744e-16Arabidopsis thaliana clone 106301 mRNA, complete sequence.766004479 (14)pir|T51442|T514422e-62seed maturation-like protein - Arabidopsis thaliana>gb:ATF2G14_1550445 Arabidops
JMSF024O17Sequence650004479 (14)gb:AY084384_15694741e-32Arabidopsis thaliana clone 106301 mRNA, complete sequence.772004479 (14)pir|T51442|T514422e-43seed maturation-like protein - Arabidopsis thaliana>gb:ATF2G14_1550445 Arabidops
JMSF032C13Sequence603004479 (14)gb:AY084384_15694741e-33Arabidopsis thaliana clone 106301 mRNA, complete sequence.729012818 (2)pir|T51442|T514425e-30seed maturation-like protein - Arabidopsis thaliana>gb:ATF2G14_1550445 Arabidops
JMSF033O13Sequence616004479 (14)gb:AY084384_15694741e-32Arabidopsis thaliana clone 106301 mRNA, complete sequence.711004479 (14)pir|T51442|T514426e-38seed maturation-like protein - Arabidopsis thaliana>gb:ATF2G14_1550445 Arabidops
JMSF042A13Sequence488004479 (14)gb:AY084384_15694741e-16Arabidopsis thaliana clone 106301 mRNA, complete sequence.601004479 (14)pir|T51442|T514423e-30seed maturation-like protein - Arabidopsis thaliana>gb:ATF2G14_1550445 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN041L20- GAGAACTAGTCTC
                      ____________________________________________________________
consensus GAGAACTAGTCTC
 
. : . : . : . : . : . :
JMFN041L20- GAGXXXXXXXXXXXXXXXXXXXXXXXXCAAAGAAATCAAATATAGGCATTTTATATACTT
rJMSF033O13- AGAAATCAGATATAGGCATTTTATATACTT
rJMSF024O17- AGAAATCAGATATAGGCATTTTATATACTT
                      ____________________________________________________________
consensus GAGNNNNNNNNNNNNNNNNNNNNNNNNCAAAGAAATCAGATATAGGCATTTTATATACTT
 
. : . : . : . : . : . :
JMFN041L20- AATTTCTCGATATATAAACAACACAAAATTTGGAAGGAAGAGGGATATACATTCATGTTT
rJMSF033O13- AATTTCTCGATATATAAACAACACAAAATTTGGAAGGAAGAGGGATATACATTCATGTTT
rJMSF042A13- ATTTCTCGATATATAAACAACACAAAATTTGGAAGGAAGAGTGATATNCATTCATGTTT
rJMSF024O17- AATTTCTCGATATATAAACAACACAAAATTTGGAAGGAAGAGGGATATACATTCATGTTT
                      ____________________________________________________________
consensus AATTTCTCGATATATAAACAACACAAAATTTGGAAGGAAGAGGGATATACATTCATGTTT
 
. : . : . : . : . : . :
JMFN041L20- ATCCTTGATTAACTTTACAATAGTCCAACAACACAACTTAAATGTAATCTGTTCTCCAAG
rJMSF033O13- ATCCTTGATTAACTTTACAATAGTCCAACAACACAACTTAAATGTAATCTGTTCTCCAAG
rJMSF042A13- ATCCTTGATTAACTTTACAATAGTCCAACAACACAACTTAAATGTAATCTGTTCTCCAAG
rJMSF024O17- ATCCTTGATTAACTTTACAATAGTCCAACAACACAACTTAAATGTAATCTGTTCTCCAAG
rJMSF003C03- ACTTTACAATAGTCCAACAACACAACTTAAATGTAATCTGTTCTCCAAG
rJMSF017D18- CAACTTAAATGTAATCTGTTCTCCAAG
                      ____________________________________________________________
consensus ATCCTTGATTAACTTTACAATAGTCCAACAACACAACTTAAATGTAATCTGTTCTCCAAG
 
. : . : . : . : . : . :
JMFN041L20- CCTCTCAAGTGATGGCCAAGTAACATACACCAAAACAGAAGCTTTGCCAAGTAATCCCGT
rJMSF033O13- CCTCTCAAGTGATGGCCAAGTAACATACACCAGAACAGAAGCTTTGCCAAGTAATCCCGT
rJMSF042A13- CCTCTCAAGTGATGGCCAAGTAACATACACCAGAACAGAAGCTTTGCCAAGTAATCCCGT
rJMSF024O17- CCTCTCAAGTGATGGCCAAGTAACATACACCAGAACAGAAGCTTTGCCAAGTAATCCCGT
rJMSF003C03- CCTCTCAAGTGATGGCCAAGTAACATACACCAGAACAGAAGCTTTGCCAAGTAATCCCGT
rJMSF017D18- CCTCTCAAGTGATGGCCAAGTAACATACACCAGAACAGAAGCTTTGCCAAGTAATCCCGT
                      ____________________________________________________________
consensus CCTCTCAAGTGATGGCCAAGTAACATACACCAGAACAGAAGCTTTGCCAAGTAATCCCGT
 
. : . : . : . : . : . :
JMFN041L20- GATGTGCCTATTGTGTCACATGATTCGGCATCAGTCTGGCGGTTTGTTGCAGCAGCTTCA
rJMSF033O13- GATGTGCCTATTGTGTCACATGATTCGGCATCAGTCTGGCGGTTTGTTGCAGCAGCTTCA
rJMSF042A13- GATGTGCCTATTGTGTCACATGATTCGGCATCAGTCTGGCGGTTTGTTGCAGCAGCTTCA
rJMSF024O17- GATGTGCCTATTGTGTCACATGATTCGGCATCAGTCTGGCGGTTTGTTGCAGCAGCTTCA
rJMSF003C03- GATGTGCCTATTGTGTCACATGATTCGGCATCAGTCTGGCGGTTTGTTGCAGCAGCTTCA
rJMSF017D18- GATGTGCCTATTGTGTCACATGATTCGGCATCAGTCTGGCGGTTTGTTGCAGCAGCTTCA
                      ____________________________________________________________
consensus GATGTGCCTATTGTGTCACATGATTCGGCATCAGTCTGGCGGTTTGTTGCAGCAGCTTCA
 
. : . : . : . : . : . :
JMFN041L20- AACAATATGCTTTCTTCGGACTCAAAGTCCGTCTCTTCTTTGAAAAATATTCGCAGTATG
rJMSF033O13- AACAATATGCTTTCTTCGGACTCAGAGTCCGTCTCTTCTTTGAAAAATATTCGCAGTATG
rJMSF042A13- AACAATATGCTTTCTTCGGACTCAGAGTCCGTCTCTTCTTTGAAAAATATTCGCAGTATG
rJMSF024O17- AACAATATGCTTTCTTCGGACTCAGAGTCCGTCTCTTCTTTGAAAAATATTCGCAGTATG
rJMSF003C03- AACAATATGCTTTCTTCGGACTCAGAGTCCGTCTCTTCTTTGAAAAATATTCGCAGTATG
rJMSF017D18- AACAATATGCTTTCTTCGGACTCAGAGTCCGTCTCTTCTTTGAAAAATATTCGCAGTATG
                      ____________________________________________________________
consensus AACAATATGCTTTCTTCGGACTCAGAGTCCGTCTCTTCTTTGAAAAATATTCGCAGTATG
 
. : . : . : . : . : . :
JMFN041L20- TTCTGTGCTAATTGATGAATAACTTCCTCCACTTCAAACGAGGATGGCTTAAAAAGTTCA
rJMSF033O13- TTCTGTGCTAATTGATGAATAACTTCCTCCACTTCAAACGAGGATGGCTTAGAAAGTTCA
rJMSF042A13- TTCTGTGCTAATTGATGAATAACTTCCTCCACTTCAAACGAGGATGGCTTAGAAAGTTCA
rJMSF024O17- TTCTGTGCTAATTGATGAATAACTTCCTCCACTTCAAACGAGGATGGCTTAGAAAGTTCA
rJMSF003C03- TTCTGTGCTAATTGATGAATAACTTCCTCCACTTCAAACGAGGATGGCTTAGAAAGTTCA
rJMSF017D18- TTCTGTGCTAATTGATGAATAACTTCCTCCACTTCAAACGAGGATGGCTTAGAAAGTTCA
                      ____________________________________________________________
consensus TTCTGTGCTAATTGATGAATAACTTCCTCCACTTCAAACGAGGATGGCTTAGAAAGTTCA
 
. : . : . : . : . : . :
JMFN041L20- ATCACCATATCAGGTTCCAAAAACCGAAGATACTCGAGCAGATCATTGTTACTTCTTTTG
rJMSF033O13- ATCACCATATCAGGTTCCAAAAACCGAAGATACTCGAGCAGATCATTGTTACTTCTTTTG
rJMSF042A13- ATCACCATATCAGGTTCCAAAAACCGAAGATACTCGAGCAGATCATTGTTACTTCTTTTG
rJMSF024O17- ATCACCATATCAGGTTCCAAAAACCGAAGATACTCGAGCAGATCATTGTTACTTCTTTTG
rJMSF003C03- ATCACCATATCAGGTTCCAAAAACCGAAGATACTCGAGCAGATCATTGTTACTTCTTTTG
rJMSF017D18- ATCACCATATCAGGTTCCAAAAACCGAAGATACTCGAGCAGATCATTGTTACTTCTTTTG
                      ____________________________________________________________
consensus ATCACCATATCAGGTTCCAAAAACCGAAGATACTCGAGCAGATCATTGTTACTTCTTTTG
 
. : . : . : . : . : . :
JMFN041L20- TCATAGTCCATTTGCAAATTTTCCTGATTCAAAGCATGCAGGTC
rJMSF033O13- TCATAGTCCATTTGCAAATTTTCCTGATTCAGAGCATGCAGGTCCTGTTTAACTGTTTTC
rJMSF042A13- TCATAGTCCATTTGCAAATTTTCCTGATTCAGAGCATGCAGGTCCTG
rJMSF024O17- TCATAGTCCATTTGCAAATTTTCCTGATTCAGAGCATGCAGGTCCTGTTTAACTGTTTTC
rJMSF003C03- TCATAGTCCATTTGCAAATTTTCCTGATTCAGAGCATGCAGGTCCTGTTTAACTGTTTTC
rJMSF017D18- TCATAGTCCATTTGCAAATTTTCCTGATTCAGAGCATGCAGGTCCTGTTTAACTGTTTTC
JMFN030N13+ CTGTTTAACTGTTTTC
                      ____________________________________________________________
consensus TCATAGTCCATTTGCAAATTTTCCTGATTCAGAGCATGCAGGTCCTGTTTAACTGTTTTC
 
. : . : . : . : . : . :
rJMSF033O13- AGCTCCATTTCTAATTGCTGAATATAGTTCAGAGCTTCAGGAGACAAATCCTCAAAATTT
rJMSF024O17- AGCTCCATTTCTAATTGCTGAATATAGTTCAGAGCTTCAGGAGACAAATCCTCAAAATTT
rJMSF003C03- AGCTCCATTTCTAATTGCTGAATATAGTTCAGAGCTTCAGGAGACAAATCCTCAAAATTT
rJMSF017D18- AGCTCCATTTCTAATTGCTGAATATAGTTCAGAGCTTCAGGAGACAAATCCTCAAAATTT
JMFN030N13+ AGCTCCATTTCTAATTGCTGAATATAGTTCAGAGCTTCAGGAGACAAATCCTCAAAATTT
                      ____________________________________________________________
consensus AGCTCCATTTCTAATTGCTGAATATAGTTCAGAGCTTCAGGAGACAAATCCTCAAAATTT
 
. : . : . : . : . : . :
rJMSF033O13- TGACTAATAATGGTATCTGAAGCTACGTTGCAACCATCTGCACCACTTTCAATTTCTTGA
rJMSF024O17- TGACTAATAATGGTATCTGAAGCTACGTTGCAACCATCTGCACCACTTTCAATTTCTTGA
rJMSF003C03- TGACTAATAATGGTATCTGAAGCTACGTTGCAACCATCTGCACCACTTTCAATTTCTTGA
rJMSF017D18- TGACTAATAATGGTATCTGAAGCTACGTTGCAACCATCTGCACCACTTTCAATTTCTTGA
JMFN030N13+ TGACTAATAATGGTATCTGAAGCTACGTTGCAACCATCTGCACCACTTTCAATTTCTTGA
JMSF033O13+ CTTGA
JMSF024O17+ TACGTTGCAACCATCTGCACCACTTTCAATTTCTTGA
                      ____________________________________________________________
consensus TGACTAATAATGGTATCTGAAGCTACGTTGCAACCATCTGCACCACTTTCAATTTCTTGA
 
. : . : . : . : . : . :
rJMSF033O13- ATACTAACTTCCTCCCCCTTTACGCATGGATCCTCATTTCCATCTCCATAGTTCAAGTTT
rJMSF024O17- ATACTAACTTCCTCCCCCTTTACGCATGGATCCTCATTTCCATCTCCATAGTTCAGGTTT
rJMSF003C03- ATACTAACTTCCTCCCCCTTTACGCATGGATCCTCATTTCCATCTCCATAGTTCAAGTTT
rJMSF017D18- ATACTAACTTCCTCCCCCTTTACGCATGGATCCTCATTTCCATCTCCATAGTTCAAGTTT
JMFN030N13+ ATACTAACTTCCTCCCCCTTTACGCATGGATCCTCATTTCCATCTCCATAGTTCAAGTTT
JMSF033O13+ ATACTAACTTCCTCCCCCTTTACGCATGGATCCTCATTTCCATCTCCATAGTTCAAGTTT
JMSF024O17+ ATACTAACTTCCTCCCCCTTTACGCATGGATCCTCATTTCCATCTCCATAGTTCAAGTTT
                      ____________________________________________________________
consensus ATACTAACTTCCTCCCCCTTTACGCATGGATCCTCATTTCCATCTCCATAGTTCAAGTTT
 
. : . : . : . : . : . :
rJMSF033O13- TTGGA
rJMSF024O17- TTGGAATTATTTGATGAAATGTCAAAATTCCTCATCAACGATATTCTGTACTCCGCATTC
rJMSF003C03- TTGGAATTATTTGATGAAATGTCAAAATTCCTCATCAACGATATTCTGTACTCCGCATTC
rJMSF017D18- TTGGAATTATTTGATGAAATGTCAAAATTCCTCATCAACGATATTCTGTACTCCGCATTC
JMFN030N13+ TTGGAATTATTTGATGAAATGTCAAAATTCCTCATCAACGATATTCTGTACTCCGCATTC
JMSF033O13+ TTGGAATTATTTGATGAAATGTCAAAATTCCTCATCAACGATATTCTGTACTCCGCATTC
JMSF024O17+ TTGGAATTATTTGATGAAATGTCAAAATTCCTCATCAACGATATTCTGTACTCCGCATTC
JMSF032C13+ TTTGATGAAATGTCAAAATTCCTCATCAACGATATTCTGTACTCCGCATTC
                      ____________________________________________________________
consensus TTGGAATTATTTGATGAAATGTCAAAATTCCTCATCAACGATATTCTGTACTCCGCATTC
 
. : . : . : . : . : . :
rJMSF024O17- C
rJMSF003C03- CACAATGTATACCCGGTGATTATGGAAGAAACAATTAGGCGATGAAGTGGGTGCTTTGAA
rJMSF017D18- CACAATGTATACCCGGTGATTATGGAAGAAACAATTAGGCGATGAAGTGGGTGCTTTGAA
JMFN030N13+ CACAATGTATACCCGGTGATTATGGAAGAAACAATTAGGCGATGAAGTGGGTGCTTTGAA
JMSF033O13+ CCCAATGTATACCCGGTGATTATGGAAGAAACAATTAGGCGATGAAGTGGGTGCTTTGAA
JMSF024O17+ CCCAATGTATACCCGGTGATTATGGAAGAAACAATTAGGCGATGAAGTGGGTGCTTTGAA
JMSF032C13+ CACAATGTATACCCGGTGATTATGGAAGAAACAATTAGGCGATGAAGTGGGTGCTTTGAA
                      ____________________________________________________________
consensus CACAATGTATACCCGGTGATTATGGAAGAAACAATTAGGCGATGAAGTGGGTGCTTTGAA
 
. : . : . : . : . : . :
rJMSF003C03- AACCTAACAGTGACGGAGAACTGATCCGAGGGTAGCAACCCTAGCATCGTCGATATGGTC
rJMSF017D18- AACCTAACAGTGACGGAGAACTGATCCGAGGGTAGCAACCCTAGCATCGTCGATATGGTC
JMFN030N13+ AACCTAACAGTGACGGAGAACTGATCCGAGGGTAGCAACCCTAGCATCGTCGATATGGTC
JMSF033O13+ AACCTAACAGTGACGGAGAACTGATCCGAGGGTAGCAACCCTAGCATCGTCGATATGGTC
JMSF007G10+ AACAGTGACGGAGAACTGATCCGAGGGTAGCAACCCTAGCATCGTCGATATGGTC
JMSF024O17+ AACCTAACAGTGACGGAGAACTGATCCGAGGGTAGCAACCCTAGCATCGTCGATATGGTC
JMSF042A13+ TAACAGTGACGGAGAACTGATCCGAGGGTAGCAACCCTAGCATCGTCGATATGGTC
JMSF032C13+ AACCTAACAGTGACGGAGAACTGATCCGAGGGTAGCAACCCTAGCATCGTCGATATGGTC
JMSF017D18+ AGTGACGGAGAACTGATCCGAGGGTAGCAACCCTAGCATCGTCGATATGGTC
                      ____________________________________________________________
consensus AACCTAACAGTGACGGAGAACTGATCCGAGGGTAGCAACCCTAGCATCGTCGATATGGTC
 
. : . : . : . : . : . :
rJMSF003C03- TGCT
rJMSF017D18- TGCTTCATAGAGTCCT
JMFN030N13+ TGCTTCATAGAGTCCTTAGCAGCAGCG
JMSF033O13+ TGCTTCATAGAGTCCTTAGCAGCAGCGGAAACGCCTTCTGAAATAACTGAAGTGTCCAAA
JMSF007G10+ TGCTTCATAGAGTCCTTAGCAGCAGCGGAAACGCCTTCTGAAATAACTGAAGTGTCCAAA
JMSF024O17+ TGCTTCATAGAGTCCTTAGCAGCAGCGGAAACGCCTTCTGAAATAACTGAAGTGTCCAAA
JMSF042A13+ TGCTTCATAGAGTCCTTAGCAGCAGCGGAAACGCCTTCTGAAATAACTGAAGTGTCCAAA
JMSF032C13+ TGCTTCATAGAGTCCTTAGCAGCAGCGGAAACGCCTTCTGAAATAACTGAAGTGTCCAAA
JMSF017D18+ TGCTTCATAGAGTCCTTAGCAGCAGCGGAAACGCCTTCTGAAATAACTGAAGTGTCCAAA
                      ____________________________________________________________
consensus TGCTTCATAGAGTCCTTAGCAGCAGCGGAAACGCCTTCTGAAATAACTGAAGTGTCCAAA
 
. : . : . : . : . : . :
JMSF033O13+ GGCTCAATTCGCTTGAGCATATTGGCGATTACGGCGAATTCGCGGCCGAAACCAGACTTG
JMSF007G10+ GGCTCAATTCGCTTGAGCATATTGGCGATTACGGCGAATTCGCGGCCGAAACCAGACTTG
JMSF024O17+ GGCTCAATTCGCTTGAGCATATTGGCGATTACGGCGAATTCGCGGCCGAAACCAGACTTG
JMSF042A13+ GGCTCAATTCGCTTGAGCATATTGGCGATTACGGCGAATTCGCGGCCGAAACCAGACTTG
JMSF032C13+ GGCTCAATTCGCTTGAGCATATTGGCGATTACGGCGAATTCGCGGCCGAAACCAGACTTG
JMSF017D18+ GGCTCAATTCGCTTGAGCATATTGGCGATTACGGCGAATTCGCGGCCGAAACCAGACTTG
                      ____________________________________________________________
consensus GGCTCAATTCGCTTGAGCATATTGGCGATTACGGCGAATTCGCGGCCGAAACCAGACTTG
 
. : . : . : . : . : . :
JMSF033O13+ GTGGTGGAGACGAAGTCGTCGGAGACGCCGCCCCCATCAACTCCAGACACGAGACAGCTG
JMSF007G10+ GTGGTGGAGACGAAGTCGTCGGAGACGCCGCCCCCATCAACTCCAGACACGAGACAGCTG
JMSF024O17+ GTGGTGGAGACGAAGTCGTCGGAGACGCCGCCCCCATCAACTCCAGACACGAGACAGCTG
JMSF042A13+ GTGGTGGAGACGAAGTCGTCGGAGACGCCGCCCCCATCAACTCCAGACACGAGACAGCTG
JMSF032C13+ GTGGTGGAGACGAAGTCGTCGGAGACGCCGCCCCCATCAACTCCAGACACGAGACAGCTG
JMSF017D18+ GTGGTGGAGACGAAGTCGTCGGAGACGCCGCCCCCATCAACTCCAGACACGAGACAGCTG
JMSF003C03+ GAGACGCCGCCCCCATCAACTCCAGACACGAGACAGCTG
                      ____________________________________________________________
consensus GTGGTGGAGACGAAGTCGTCGGAGACGCCGCCCCCATCAACTCCAGACACGAGACAGCTG
 
. : . : . : . : . : . :
JMSF033O13+ ACGGCAGCAAAAGACGAAGGCCGGCGTCTAGAAGAAGTGGGCGCGGCCGGAAGAAACGGG
JMSF007G10+ ACGGCAGCAAAAGACGAAGGCCGGCGTCTAGAAGAAGTGGGCGCGGCCGGAAGAAACGGG
JMSF024O17+ ACGGCAGCAAAAGACGAAGGCCGGCGTCTAGAAGAAGTGGGCGCGGCCGGAAGAAACGGG
JMSF042A13+ ACGGCAGCAAAAGACGAAGGCCGGCGTCTAGAAGAAGTGGGCGCGGCCGGAAGAAACGGG
JMSF032C13+ ACGGCAGCAAAAGACGAAGGCCGGCGTCTAGAAGAAGTGGGCGCGGCCGGAAGAAACGGG
JMSF017D18+ ACGGCAGCAAAAGACGAAGGCCGGCGTCTAGAAGAAGTGGGCGCGGCCGGAAGAAACGGG
JMSF003C03+ ACGGCAGCAAAAGACGAAGGCCGGCGTCTAGAAGAAGTGGGCGCGGCCGGAAGAAACGGG
                      ____________________________________________________________
consensus ACGGCAGCAAAAGACGAAGGCCGGCGTCTAGAAGAAGTGGGCGCGGCCGGAAGAAACGGG
 
. : . : . : . : . : . :
JMSF033O13+ CGGATGAGGAGGTGGTGCGCGAAGGGAGGCGGTGGTTGCGGTGGCTGGAGCGGCTTCAGT
JMSF007G10+ CGGATGAGGAGGTGGTGCGCGAAGGGAGGCGGTGGTTGCGGTGGCTGGAGCGGCTTCAGT
JMSF024O17+ CGGATGAGGAGGTGGTGCGCGAAGGGAGGCGGTGGTTGCGGTGGCTGGAGCGGCTTCAGT
JMSF042A13+ CGGATGAGGAGGTGGTGCGCGAAGGGAGGCGGTGGTTGCGGTGGCTGGAGCGGCTTCAGT
JMSF032C13+ CGGATGAGGAGGTGGTGCGCGAAGGGAGGCGGTGGTTGCGGTGGCTGGAGCGGCTTCAGT
JMSF017D18+ CGGATGAGGAGGTGGTGCGCGAAGGGAGGCGGTGGTTGCGGTGGCTGGAGCGGCTTCAGT
JMSF003C03+ CGGATGAGGAGGTGGTGCGCGAAGGGAGGCGGTGGTTGCGGTGGCTGGAGCGGCTTCAGT
                      ____________________________________________________________
consensus CGGATGAGGAGGTGGTGCGCGAAGGGAGGCGGTGGTTGCGGTGGCTGGAGCGGCTTCAGT
 
. : . : . : . : . : . :
JMSF033O13+ GACAGCTCGGCGAGGCGAGATATGAGAAAAGCGCGAGCTATGGAAGCCATAGAAAGAGAG
JMSF007G10+ GACAGCTCGGCGAGGCGAGATATGAGAAAAGCGCGAGCTATGGAAGCCATAGAAAGAGAG
JMSF024O17+ GACAGCTCGGCGAGGCGAGATATGAGAAAAGCGCGAGCTATGGAAGCCATAGAAAGAGAG
JMSF042A13+ GACAGCTCGGCGAGGCGAGATATGAGAAAAGCGCGAGCTATGGAAGCCATAGAAAGAGAG
JMSF032C13+ GACAGCTCGGCGAGGCGAGATATGAGAAAAGCGCGAGCTATGGAAGCCATAGAAAGAGAG
JMSF017D18+ GACAGCTCGGCGAGGCGAGATATGAGAAAAGCGCGAGCTATGGAAGCCATAGAAAGAGAG
JMSF003C03+ GACAGCTCGGCGAGGCGAGATATGAGAAAAGCGCGAGCTATGGAAGCCATAGAAAGAGAG
                      ____________________________________________________________
consensus GACAGCTCGGCGAGGCGAGATATGAGAAAAGCGCGAGCTATGGAAGCCATAGAAAGAGAG
 
. : . : . : . : . : . :
JMSF033O13+ ATTGGCG
JMSF007G10+ ATTGGC
JMSF024O17+ ATTGGCG
JMSF042A13+ ATTGGCGAGCTTGCAGCTCACAAAGCTTATCCTTTTTGTGGCTTTGGATCCCTCCGGCAA
JMSF032C13+ ATTGGCGAGCTTGCAGCTCACAAAGCTTATCCTTTTTGTGGCTTTGGATCCCTCCGGCAA
JMSF017D18+ ATTGGCGAGCTTGCAGCTCACAAAGCTTATCCTTTTTGTGGCTTTGGATCCCTCCGGCAA
JMSF003C03+ ATTGGCGAGCTTGCAGCTCACAAAGCTTATCCTTTTTGTGGCTTTGGATCCCTCCGGCAA
                      ____________________________________________________________
consensus ATTGGCGAGCTTGCAGCTCACAAAGCTTATCCTTTTTGTGGCTTTGGATCCCTCCGGCAA
 
. : . : . : . : . : . :
JMSF042A13+ TGCTATCTCTC
JMSF032C13+ TGCTATCTCTC
JMSF017D18+ TGCTATCTCTCACCAGTCAGTCACGACCGCTTTCGAATCTCAGTCC
JMSF003C03+ TGCTATCTCTCACCAGTCAGTCACGACCGCTTTCGAATCTCTGTCCGCCTCATCTTTCCC
                      ____________________________________________________________
consensus TGCTATCTCTCACCAGTCAGTCACGACCGCTTTCGAATCTCTGTCCGCCTCATCTTTCCC