Previous Contig 004477:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041O20Sequence605004477 (6)pir|T51837|T518375e-48MTN3 homolog [imported] - Arabidopsis thaliana>gb:AB025633_1516602 Arabidopsis t620004477 (6)gb:AY375342_11780761e-12Gossypium barbadense fiber protein Fb31 mRNA, partial cds.
JMFN015F03Sequence606004477 (6)gb:AY375342_11780762e-24Gossypium barbadense fiber protein Fb31 mRNA, partial cds.
JMFS156B01Sequence604004477 (6)pir|T51837|T518371e-49MTN3 homolog [imported] - Arabidopsis thaliana>gb:AB025633_1516602 Arabidopsis t
JMSF003C01Sequence353004477 (6)gb:AF151726_17727248e-22Dianthus caryophyllus putative MtN3-like protein mRNA, complete cds.768004477 (6)gb:AY375342_11780765e-36Gossypium barbadense fiber protein Fb31 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF041O20- ATACAAACAAAATTAATAGCTTATTATTACGTAATTTAATTCTC
rJMSF003C01- ATTCTC
                      ____________________________________________________________
consensus ATACAAACAAAATTAATAGCTTATTATTACGTAATTTAATTCTC
 
. : . : . : . : . : . :
rJMFF041O20- GCTTAATTATTTTTTCACCGAATTACAATTCTTTCCCACCTTAATTCCCTTATCCCAACC
JMFN015F03+ ATCCCAACC
rJMSF003C01- GCTTAATTATTTTTTCACCGAATTACAATTCTTTCCCACCTTAATTCCCTTATCCCAACC
                      ____________________________________________________________
consensus GCTTAATTATTTTTTCACCGAATTACAATTCTTTCCCACCTTAATTCCCTTATCCCAACC
 
. : . : . : . : . : . :
rJMFF041O20- AAACGCCATGTAAAGGAAAGATAAAGAATATAATAATAATAATATAATTAAGCAGCACAG
JMFN015F03+ AACGGCCATGTAAAGGAAAGATAAAGAATATAATAATAATAATATAATTAAGCAGCACAG
rJMSF003C01- AAACGCCATGTAAAGGAAAGATAAAGAATATAATAATAATAATATAATTAAGCAGCACAG
                      ____________________________________________________________
consensus AAACGCCATGTAAAGGAAAGATAAAGAATATAATAATAATAATATAATTAAGCAGCACAG
 
. : . : . : . : . : . :
rJMFF041O20- AGGACGACGGCCGCCGACGGCGGCTCAATTTGCGCATTCACAGGGTGGGTGAATTGGAGG
JMFN015F03+ AGGACGACGGCCGCCGACGGCGGCTCAATTTGCGCATTCACAGGGTGGGTGAATTGGAGG
rJMSF003C01- AGGACGACGGCCGCCGACGGCGGCTCAATTTGCGCATTCACAGGGTGGGTGAATTGGAGG
                      ____________________________________________________________
consensus AGGACGACGGCCGCCGACGGCGGCTCAATTTGCGCATTCACAGGGTGGGTGAATTGGAGG
 
. : . : . : . : . : . :
rJMFF041O20- ACATTATCGTCAAGATTAGGATTTGCCGGCGGCAGAGGCTGTGGCGCCGTAATCATCATG
JMFN015F03+ ACATTATCGTCAAGATTAGGATTTGCCGGCGGCAGAGGCTGTGGCGCTGTAATCATCATG
rJMSF003C01- ACATTATCGTCAAGATTAGGATTTGCCGGCGGCAGAGGCTGTGGCGCCGTAATCATCATG
                      ____________________________________________________________
consensus ACATTATCGTCAAGATTAGGATTTGCCGGCGGCAGAGGCTGTGGCGCCGTAATCATCATG
 
. : . : . : . : . : . :
rJMFF041O20- GTTTTCCCGGCGCGGTTTTCTTCTTCTTTTTCCTCTTCTTTGCTCTTTTGATCTGGCTTT
JMFN015F03+ GTTTTCCCGGCGCGGTTTTCTTCTTCTTTTTCCTCTTCTTTGCTCTTTTGATCTGGCTTT
rJMSF003C01- GTTTTCCCGGCGCGGTTTTCTTCTTCTTTTTCCTCTTCTTTGCTCTTTTGATCTGGCTTT
                      ____________________________________________________________
consensus GTTTTCCCGGCGCGGTTTTCTTCTTCTTTTTCCTCTTCTTTGCTCTTTTGATCTGGCTTT
 
. : . : . : . : . : . :
rJMFF041O20- TCTGCTTTTTCTTCAGTAACGGCGTCACTGACGGTGATGGCTGTCGTCTTAGAATCCTCC
JMFN015F03+ TCTGCTTTTTCTTCAGTAACGGCGTCACTGACGGTGATGGCTGTCGTCTTAGAATCCTCC
rJMSF003C01- TCTGCTTTTTCTTCAGTAACGGCGTCACTGACGGTGATGGCTGTCGTCTTAGAATCCTCC
                      ____________________________________________________________
consensus TCTGCTTTTTCTTCAGTAACGGCGTCACTGACGGTGATGGCTGTCGTCTTAGAATCCTCC
 
. : . : . : . : . : . :
rJMFF041O20- ACAGATGAGTGCAATAATTCCCCTAGCCCTGCCACGTTTATAACGAGCTCTGGCACGGCG
JMFN015F03+ ACAGATGAGTGCAATAATTCCCCTAGCCCTGCCACGTTTATAACGAGCTCTGGCACGGCG
rJMSF003C01- ACAGATGAGTGCAATAATTCCCCTAGCCCTGCCACGTTTATAACGAGCTCTGGCACGGCG
                      ____________________________________________________________
consensus ACAGATGAGTGCAATAATTCCCCTAGCCCTGCCACGTTTATAACGAGCTCTGGCACGGCG
 
. : . : . : . : . : . :
rJMFF041O20- CCCTTTTTCTCCTCCGCCACTTCAAGTGGCTTCTGGTTTCTGTAGATTCCGTATAACACC
JMFN015F03+ CCCTTTTTCTCCTCCGCCACTTCAAGTGGCTTCTGGTTTCTGTAGATTCCGTATAGCACC
rJMSF003C01- CCCTTTTTCTCCTCCGCCACTTCAAGTGGCTTCTGGTTTCTGTAGATTCCGTATAACACC
                      ____________________________________________________________
consensus CCCTTTTTCTCCTCCGCCACTTCAAGTGGCTTCTGGTTTCTGTAGATTCCGTATAACACC
 
. : . : . : . : . : . :
rJMFF041O20- ATTTGTACGATTCCCAATAAAAACCCCAAAACGTTTGGTAAAGCAATGCACATGTCCTTC
JMFN015F03+ ATTTGTACGATTCCCAATAAAAACCCCAAAACGTTTGGTAAAGCAATGCACATGTCCTTC
rJMSF003C01- ATTTGTACGATTCCCAATAAAAACCCCAAAACGTTTGGTAAAGCAATGCACATGTCCTTC
                      ____________________________________________________________
consensus ATTTGTACGATTCCCAATAAAAACCCCAAAACGTTTGGTAAAGCAATGCACATGTCCTTC
 
. : . : . : . : . : . :
rJMFF041O20- AACAACAAGCCATAGCCTAACCACATAACTGCAGTC
JMFN015F03+ AACAACAAGCCATAGCCTAACCACATAACTGCAGTCAACGTAAGGAAGAAAGACAGGTTG
rJMSF003C01- AACAACAAGCCATAGCCTAACCACATAACTGCAGTCAACGTAAGGAAGAAAGACAGGTTG
                      ____________________________________________________________
consensus AACAACAAGCCATAGCCTAACCACATAACTGCAGTCAACGTAAGGAAGAAAGACAGGTTG
 
. : . : . : . : . : . :
JMFN015F03+ AACGGCATGAACTCTACGCTCTTTGTCTTCACCACTTTGAACACAATGCTAAGAGGC
rJMSF003C01- AACGGCATGAACTCTACGCTCTTTGTCTTCACCACTTTGAACACAATGCTAAGAGGCGCA
JMFS156B01+ TCACCACTTTGAACACAATGCTAAGAGGCGCA
JMFF041O20+ GAGGCGCA
                      ____________________________________________________________
consensus AACGGCATGAACTCTACGCTCTTTGTCTTCACCACTTTGAACACAATGCTAAGAGGCGCA
 
. : . : . : . : . : . :
rJMSF003C01- GCGAAAACGCAGACGGAAAAAGCCACACAAATCCATCCCACAATGTTGACACGAAGGGTG
JMFS156B01+ GCGAAAACGCAGACGGAAAAAGCCACACAAATCCATCCCACAATGTTGACACGAAGGGTG
JMFF041O20+ GCGAAAACGCAGACGGAAAAAGCCACACAAATCCATCCCACAATGTTGACACGAAGGGTG
                      ____________________________________________________________
consensus GCGAAAACGCAGACGGAAAAAGCCACACAAATCCATCCCACAATGTTGACACGAAGGGTG
 
. : . : . : . : . : . :
rJMSF003C01- CCCTTAAAAGGGAACATTGTGGCCAACACAATCACAGAGTAG
JMFS156B01+ CCCTTAAAAGGGAACATTGTGGCCAACACAATCACAGAGTAGAGCCCTCCAAAAAGTAAC
JMFF041O20+ CCCTTAAAAGGGAACATTGTGGCCAACACAATCACAGAGTAGAGCCCTCCAACAAGTAAC
                      ____________________________________________________________
consensus CCCTTAAAAGGGAACATTGTGGCCAACACAATCACAGAGTAGAGCCCTCCAACAAGTAAC
 
. : . : . : . : . : . :
JMFS156B01+ AACAACATCTTCATGGTTTGACGTCTAGCGATTTTGGAAGCATAACCAAGGAAAATGGAG
JMFF041O20+ AACAACATCTTCATGGTTTGACGTCTAGCGATTTTGGAAGCATAACCAAGGAAAATGGAG
                      ____________________________________________________________
consensus AACAACATCTTCATGGTTTGACGTCTAGCGATTTTGGAAGCATAACCAAGGAAAATGGAG
 
. : . : . : . : . : . :
JMFS156B01+ ATGTAAAGTGTTTCGATGACACATCCGATGGAGTTGATGGAGATGAGAAGAGGAGCACTC
JMFF041O20+ ATGTAAAGTGTTTCGATGACACATCCGATGGAGTTGATGGAGATGAGAAGAGGAGCACTC
                      ____________________________________________________________
consensus ATGTAAAGTGTTTCGATGACACATCCGATGGAGTTGATGGAGATGAGAAGAGGAGCACTC
 
. : . : . : . : . : . :
JMFS156B01+ TTCTTGAGGAAAGCATAGTACATCCACAACATAGCAGAAAATAAGGATACAACATAGGGA
JMFF041O20+ TTCTTGAGGAAAGCATAGTACATCCACAACATAGCAGAAAATAAGGATACAACATAGGGA
JMSF003C01+ GGAAAGCATAGTACATCCACAACATAGCAGAAAATAAGGATACAACATAGGGA
                      ____________________________________________________________
consensus TTCTTGAGGAAAGCATAGTACATCCACAACATAGCAGAAAATAAGGATACAACATAGGGA
 
. : . : . : . : . : . :
JMFS156B01+ ACGGATTGATAACCCAAGCTTGATTTTGCTTTATAGATTCTTATAAATGTCGGCACTGGG
JMFF041O20+ ACGGATTGATAACCCAAGGTTGATTTTGCTTTATAGATTCTTATAAATGTCGGCACTGGG
JMSF003C01+ ACGGATTGATAACCCAAGGTTGATTTTGCTTTATAGATTCTTATAAATGTCGGCACTGGG
                      ____________________________________________________________
consensus ACGGATTGATAACCCAAGGTTGATTTTGCTTTATAGATTCTTATAAATGTCGGCACTGGG
 
. : . : . : . : . : . :
JMFS156B01+ GCTAAGAATACAAGAAGTGATACAATGTTACCAAGGACTCCAAACACAAAGACCCATGGG
JMFF041O20+ GCTAAGAATACAAGAAGTGATACAATGTTACCAAGGACTCCAAACACAAAGACCCATGGG
JMSF003C01+ GCTAAGAATACAAGAAGTGATACAATGTTACCAAGGACTCCAAACACAAAGACCCATGGG
                      ____________________________________________________________
consensus GCTAAGAATACAAGAAGTGATACAATGTTACCAAGGACTCCAAACACAAAGACCCATGGG
 
. : . : . : . : . : . :
JMFS156B01+ TGATGAAGATCAAACAATGCCATCTCTTTGAATGGGTATGTAGGAAAAGTACTCAAACCT
JMFF041O20+ TGATGAAGATCAAACAATGCCATCTCTTTGAATGGGTATGTAGGAAAAGTACTCAAACCT
JMSF003C01+ TGATGAAGATCAAACAATGCCATCTCTTTGAATGGGTATGTAGGAAAAGTACTCAAACCT
                      ____________________________________________________________
consensus TGATGAAGATCAAACAATGCCATCTCTTTGAATGGGTATGTAGGAAAAGTACTCAAACCT
 
. : . : . : . : . : . :
JMFS156B01+ CAACTCCCTTAGCTTCTTCAACAGATCGAGATAGTTAAAGATTAATTGGTAGCAGAGTTC
JMFF041O20+ CAACTCCCTTAGCTTCTTCAACAGATCGAGATAGTTAAAGATTAATTGGTAGCAGAGTTC
JMSF003C01+ CAACTCCCTTAGCTTCTTCAACAGATCGAGATAGTTAAAGATTAATTGGTAGCAGAGTTC
                      ____________________________________________________________
consensus CAACTCCCTTAGCTTCTTCAACAGATCGAGATAGTTAAAGATTAATTGGTAGCAGAGTTC
 
. : . : . : . : . : . :
JMFS156B01+ TTGATTGAGATCAGAAACTTTGTTTCTCTCTC
JMFF041O20+ TTGATTGAGATCAGAAACTTTGTTTCTCTCTCTCTTTCTATCTCTCTCTACAATATC
JMSF003C01+ TTGATTGAGATCAGAAACTTTGTTTCTCTCTCTCTTTCTATCTCTCTCTACAATATCGTC
                      ____________________________________________________________
consensus TTGATTGAGATCAGAAACTTTGTTTCTCTCTCTCTTTCTATCTCTCTCTACAATATCGTC