Previous Contig 004473:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN014O11Sequence601004473 (6)sp|P46519|LE14_SOYBN6e-46Desiccation protectant protein Lea14 homolog.>pir|T06356|T06356 desiccation prot
JMFN015L08Sequence591004473 (6)pir|T07099|T070999e-54late embryogenesis (Lea)-like protein - tomato>gb:LEMARLEA_1684369 L.esculentum
JMFN028N20Sequence617004473 (6)pir|T07099|T070993e-54late embryogenesis (Lea)-like protein - tomato>gb:LEMARLEA_1684369 L.esculentum
JMFN031L06Sequence571004473 (6)pir|T07099|T070991e-54late embryogenesis (Lea)-like protein - tomato>gb:LEMARLEA_1684369 L.esculentum
JMSF003B11Sequence195004473 (6)gb:LELEMMI9G_16843573e-04L.esculentum Lemmi9 gene and promoter.688004473 (6)pir|T07099|T070997e-55late embryogenesis (Lea)-like protein - tomato>gb:LEMARLEA_1684369 L.esculentum

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN015L08+ GATTTGATGAAATGAAACAAGGTACATACTACATAGTGCAGAAAGCAACTTAT
rJMSF003B11- CATACTACATAGTGCAGAAAGCAACTTAT
                      ____________________________________________________________
consensus GATTTGATGAAATGAAACAAGGTACATACTACATAGTGCAGAAAGCAACTTAT
 
. : . : . : . : . : . :
JMFN015L08+ TGTAAGACTACATTATTCATCATCATCCTATGACTACATATAACACCACTGTTAATGATC
JMFN028N20+ GACTACATTATTCATCATCATCCTATGACTACATATAACACCACTGTTAATGATC
JMFN014O11+ CTGTTAATGATC
rJMSF003B11- TGTAAGACTACATTATTCATCATCATCCTATGACTACATATAACACCACTGTTAATGATC
                      ____________________________________________________________
consensus TGTAAGACTACATTATTCATCATCATCCTATGACTACATATAACACCACTGTTAATGATC
 
. : . : . : . : . : . :
JMFN015L08+ ATGTCTGTTAGGCAGCTTCTGGTTCTGATTTCTTCCAGAAATCAGAAAAGGTTGGGAGCT
JMFN028N20+ ATGTCTGTTAGGCAGCTTCTGGTTCTGATTTCTTCCAGAAATCAGAAAAGGTTGGGAGCT
JMFN014O11+ ATGTCTGTTAGGCAGCTTCTGGTTCTGATTTCTTCCAGAAATCAGAAAAGGTTGGGAGCT
JMFN031L06+ AGGCAGCTTCGGGTTCTGATTTCTTCCAGAAATCAGAAAAGGTTGGGAGCT
rJMSF003B11- ATGTCTGTTAGGCAGCTTCTGGTTCTGATTTCTTCCAGAAATCAGAAAAGGTTGGGAGCT
                      ____________________________________________________________
consensus ATGTCTGTTAGGCAGCTTCTGGTTCTGATTTCTTCCAGAAATCAGAAAAGGTTGGGAGCT
 
. : . : . : . : . : . :
JMFN015L08+ TGATCTCACCCGACTGAGACAGTGGGATGGTAAAGTTTCCAACGACAGGAAGATCAATGA
JMFN028N20+ TGATCTCACCCGACTGAGACAGTGGGATGGTAAAGTTTCCAACGACAGGAAGATCAATGA
JMFN014O11+ TGATCTCACCCGACTGAGACAGTGGGATGGTAAAGTTTCCAACGACAGGAAGATCAATGA
JMFN031L06+ GGATCTCACCCGACTGAGACAGTGGGATGGTAAAGTTTCCAACGACAGGAAGATCAATGA
rJMSF003B11- TGATCTCACCCGACTGAGACAGTGGGATGGTAAAGTTTCCAACGACAGGAAGATCAATGA
                      ____________________________________________________________
consensus TGATCTCACCCGACTGAGACAGTGGGATGGTAAAGTTTCCAACGACAGGAAGATCAATGA
 
. : . : . : . : . : . :
JMFN015L08+ TTAGACCCAAATCAAGTTGATAGTCAATGTCCCAATCTCCACCAATGTCCCTCGCCAAAC
JMFN028N20+ TTAGACCCAAATCAAGTTGATAGTCAATGTCCCAATCTCCACCAATGTCCCTCGCCAAAC
JMFN014O11+ TTAGACCCAAATCAAGTTGATAGTCAATGTCCCAATCTCCACCAATGTCCCTCGCCAAAC
JMFN031L06+ TTAGACCCAAATCAAGTTGATAGTCAATGTCCCAATCTCCACCAATGTCCCTCGCCAAAC
rJMSF003B11- TTAGACCCAAATCAAGTTGATAGTCAATGTCCCAATCTCCACCAATGTCCCTCGCCAAAC
                      ____________________________________________________________
consensus TTAGACCCAAATCAAGTTGATAGTCAATGTCCCAATCTCCACCAATGTCCCTCGCCAAAC
 
. : . : . : . : . : . :
JMFN015L08+ TCACCACCACACTGTGTGGCACCTTCACTGCCACATCAAGGGTGGTTGTTTCCTTTCCCG
JMFN028N20+ TCACCACCACACTGTGTGGCACCTTCACTGCCACATCAAGGGTGGTTGTTTCCTTTCCCG
JMFN014O11+ TCACCACCACACTGTGTGGCACCTTCACTGCCACATCAAGGGTGGTTGTTTCCTTTCCCG
JMFN031L06+ TCACCACCACACTGTGTGGCACCTTCACTGCCACATCAAGGGTGGTTGTTTCCTTTCCCG
rJMSF003B11- TCACCACCACACTGTGTGGCACCTTCACTGCCACATCAAGGGTGGTTGTTTCCTTTCCCG
                      ____________________________________________________________
consensus TCACCACCACACTGTGTGGCACCTTCACTGCCACATCAAGGGTGGTTGTTTCCTTTCCCG
 
. : . : . : . : . : . :
JMFN015L08+ TAATTGACCCTGGGTCTGGAATCGTGCCTGAAGCTATCACCCTGCCGGCGCTCTTGAGCT
JMFN028N20+ TAATTGACCCTGGGTCTGGAATCGTGCCTGAAGCTATCACCCTGCCGGCGCTCTTGAGCT
JMFN014O11+ TAATTGACCCTGGGTCTGGAATCGTGCCTGAAGCTATCACCCTGCCGGCGCTCTTGAGCT
JMFN031L06+ TAATTGACCCTGGGTCTGGAATCGTGCCTGAAGCTATCACCCTGCCGGCGCTCTTGAGCT
rJMSF003B11- TAATTGACCCTGGGTCTGGAATCGTGCCTGAAGCTATCACCCTGCCGGCGCTCTTGAGCT
                      ____________________________________________________________
consensus TAATTGACCCTGGGTCTGGAATCGTGCCTGAAGCTATCACCCTGCCGGCGCTCTTGAGCT
 
. : . : . : . : . : . :
JMFN015L08+ CGTATTTGATCTCGCAGATGGGAATGGAAACAGAGTAAGGGTTCTTGACGTCGA-CCTTA
JMFN028N20+ CGTATTTGATCTCGCAGATGGGAATGGAAACAGAGTAAGGGTTCTTGACGTCGA-CCTTA
JMFN014O11+ CGTATTTGATCTCGCAGATGGGAATGGAAACAGAGTAAGGGTTCTTGACGTCGATCCTTA
JMFN031L06+ CGTATTTGATCTCGCAGATGGGAATGGAAACAGAGTAAGGGTTCTTGACGTCGA-CCTTA
rJMSF003B11- CGTATTTGATCTCGCAGATGGGAATGGAAACAGAGTAAGGGTTCTTGACGTCGA-CCTTA
                      ____________________________________________________________
consensus CGTATTTGATCTCGCAGATGGGAATGGAAACAGAGTAAGGGTTCTTGACGTCGA-CCTTA
 
. : . : . : . : . : . :
JMFN015L08+ GCTAGAAAGGAAAAACCGTCGAATCCAACACCTTTGATATCAACGTCGGCGATGCTGGCT
JMFN028N20+ GCTAGAAAGGAAAAACCGTCGAATCCAACACCTTTGATATCAACGTCGGCGATGCTGGCT
JMFN014O11+ GCTAGAAAGGAAAAACCGTCGAATCCAACACCTTTGATATCAACGTCGGCGATGCTGGCT
JMFN031L06+ GCTAGAAAGGAAAAACCGTCGAATCCAACACCTTTGATATCAACGTCGGCGATGCTGGCT
rJMSF003B11- GCTAGAAAGGAAAAACCGTCGAATCCAACACCTTTGATATCAACGTCGGCGATGCTGGCT
JMSF003B11+ TCGGCGATGCTGGCT
                      ____________________________________________________________
consensus GCTAGAAAGGAAAAACCGTCGAATCCAACACCTTTGATATCAACGTCGGCGATGCTGGCT
 
. : . : . : . : . : . :
JMFN015L08+ TCCGGTTTCTCCATCTCCGCCAGCTTTTCTCCCACGAAATTCTTAGCCTTGTCCACCAG
JMFN028N20+ TCCGGTTTCTCCGTCTCCGCCAGCTTTTCTCCCACGAAATTCTTAGCCTTGTCCACCAGA
JMFN014O11+ TCCGGTTTCTCCATCTCCGCCAGCTTTTCTCCCACGAAATTCTTAGCCTTGTCCACCAGA
JMFN031L06+ TCCGGTTTCTCCATCTCCGCCAGCTTTTCTCCCACGAAATTCTTAGCCTTGTCCACCAGA
rJMSF003B11- TCCGGTTTCTCCATCTCCGCCAGCTTTTCTCCCACGAAATTCTTAGCCTTGTCCACCAGA
JMSF003B11+ TCCGGTTTCTCCATCTCCGCCAGCTTTTCTCCCACGAAATTCTTAGCCTTGTCCACCAGA
                      ____________________________________________________________
consensus TCCGGTTTCTCCATCTCCGCCAGCTTTTCTCCCACGAAATTCTTAGCCTTGTCCACCAGA
 
. : . : . : . : . : . :
JMFN028N20+ TCCATTTCTCAAGCTCGAAACTGAAACTAGAAGATCTGTATTTTGTCTCTTTATGCACGT
JMFN014O11+ TCCATTTCTCAAGCTCGAAACT-ATACTAGAAGATCTGTATTTTGTCTCTTTATGCACGT
JMFN031L06+ TCCATTTCTCAAGCTCGAAACTGAAACTAGAAGATCTGTATTTTGTCTCTTTATGCACGT
rJMSF003B11- TCCATTTCTCAAGCTCGAAACTGAAACTAGAAGATCTGTATTTTGTCTCTTTATGCACGT
JMSF003B11+ TCCATTTCTCAAGCTCGAAACTGAAACTAGAAGATCTGTATTTTGTCTCTTTATGCACGT
                      ____________________________________________________________
consensus TCCATTTCTCAAGCTCGAAACTGAAACTAGAAGATCTGTATTTTGTCTCTTTATGCACGT
 
. : . : . : . : . : . :
JMFN028N20+ ACGCTAATGTATTATGTATGTCA
JMFN014O11+ ACGCTAATGTATTATGTATGTCATGCAGTGTCACAAACACAGGGAGGGGA
JMFN031L06+ ACGCTAATGTATTATGTATGTCATGCAGTGTCACAAAC
rJMSF003B11- ACGCTAATGTATTATGTATGTCATGCAGTGTCACAAACACAGGGAGGGGACTTGTAAACC
JMSF003B11+ ACGCTAATGTATTATGTATGTCATGCAGTGTCACAAACACAGGGAGGGGACTTGTAAACC
                      ____________________________________________________________
consensus ACGCTAATGTATTATGTATGTCATGCAGTGTCACAAACACAGGGAGGGGACTTGTAAACC