Previous Contig 004472:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002D16Sequence227004472 (2)723011197 (2)pir|T49066|T490662e-84hypothetical protein T5P19.300 - Arabidopsis thaliana>gb:ATT5P19_1556270 Arabido
JMSF003B09Sequence226004472 (2)685011197 (2)pir|T49066|T490661e-79hypothetical protein T5P19.300 - Arabidopsis thaliana>gb:ATT5P19_1556270 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF002D16+ CGTCGACGGCGGAGGAGGAATGGCGACTAGCGGC
                      ____________________________________________________________
consensus CGTCGACGGCGGAGGAGGAATGGCGACTAGCGGC
 
. : . : . : . : . : . :
JMSF002D16+ ATCAAACCCAGCCCTACATTCAACAAATCTCTTCTTGAAATGTTGGTCGTTGTCTGCTTC
JMSF003B09+ TACATTCAACNAATCTCTTCTTGAAATGTTGGTCGTTGTCTGCTTC
                      ____________________________________________________________
consensus ATCAAACCCAGCCCTACATTCAACAAATCTCTTCTTGAAATGTTGGTCGTTGTCTGCTTC
 
. : . : . : . : . : . :
JMSF002D16+ GAGCTCCGATGGGTTTTGACGGAGAAGGGGGAGGAAGGCGACGGCGGCTTCGGATTCGAA
JMSF003B09+ GAGCTCCGATGGGTTTTGACGGAGAAGGGGGAGGAAGGCGACGGCGGCTTCGGATTCGAA
                      ____________________________________________________________
consensus GAGCTCCGATGGGTTTTGACGGAGAAGGGGGAGGAAGGCGACGGCGGCTTCGGATTCGAA
 
. : . : . : . : . : . :
JMSF002D16+ GTTGAAGAGGTTGCGGAGGAGAGCATGGAGGGCAGTAGCCTGGCTACTGAGATCGCCATT
JMSF003B09+ GTTGAAGAGGTTGCGGAGGAGAGCATGGAGGGCAGTAGCCTGGCTACTGAGATCGCCATT
                      ____________________________________________________________
consensus GTTGAAGAGGTTGCGGAGGAGAGCATGGAGGGCAGTAGCCTGGCTACTGAGATCGCCATT
 
. : . : . : . : . : . :
JMSF002D16+ TTCGCTGTGCGT
JMSF003B09+ TTCGCTGTGCGTGAGATTTGGGAGGATGAAATGAGGTGGTTGTACTCCCGCTATTATCCC
                      ____________________________________________________________
consensus TTCGCTGTGCGTGAGATTTGGGAGGATGAAATGAGGTGGTTGTACTCCCGCTATTATCCC