Previous Contig 004467:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003A07Sequence229004467 (2)747011364 (6)gb:AP003371_18286291e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMSF033P18Sequence104004467 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033P18+ GCTGGAAA
                      ____________________________________________________________
consensus GCTGGAAA
 
. : . : . : . : . : . :
JMSF033P18+ GTTTGGTAACTTTGANGAGTAAATGTGAAGTGGTCAAGAATTTGAGTAAANTATTTCGTG
JMSF003A07+ TTGAGGAGTAAATGTGAAGTGGTCAAGAATTTGAGTAAAATATTTTGTG
                      ____________________________________________________________
consensus GTTTGGTAACTTTGAGGAGTAAATGTGAAGTGGTCAAGAATTTGAGTAAAATATTTTGTG
 
. : . : . : . : . : . :
JMSF033P18+ TCATAAACTTGATNATNATAAGTGGTCTTGGTAGAA
JMSF003A07+ TCATAAACTTGATTATTATAAGTGGTCTTGGTAGAAGCTGCTGAGAACCCATCTGGCTCG
                      ____________________________________________________________
consensus TCATAAACTTGATTATTATAAGTGGTCTTGGTAGAAGCTGCTGAGAACCCATCTGGCTCG
 
. : . : . : . : . : . :
JMSF003A07+ TTGATTATGGTAGGAAATGGAAATGGAAATGTGGGTGTAGTTTTGGCAAAGGAGATAGCA
                      ____________________________________________________________
consensus TTGATTATGGTAGGAAATGGAAATGGAAATGTGGGTGTAGTTTTGGCAAAGGAGATAGCA
 
. : . : . : . : . : . :
JMSF003A07+ AAATAGGAGAAGAGGAGGAGCAATAATATTCTTGAATTCATGATTGTGCTTGTATACATC
                      ____________________________________________________________
consensus AAATAGGAGAAGAGGAGGAGCAATAATATTCTTGAATTCATGATTGTGCTTGTATACATC