Previous Contig 004465:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS006E08Sequence567004465 (5)gb:AY357949_16019294e-10Arabidopsis thaliana ecotype C24 YDA (At1g63700) gene, complete cds.
JMFS006E11Sequence565004465 (5)gb:AY357949_16019293e-09Arabidopsis thaliana ecotype C24 YDA (At1g63700) gene, complete cds.
JMFS142F06Sequence620004465 (5)gb:AY357949_16019292e-14Arabidopsis thaliana ecotype C24 YDA (At1g63700) gene, complete cds.
JMSF002P24Sequence314004465 (5)700012404 (3)
JMSF025F01Sequence671004465 (5)gb:AY357949_16019293e-11Arabidopsis thaliana ecotype C24 YDA (At1g63700) gene, complete cds.738012404 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS142F06+ ATATTAGCTGACTTTGAAGTTTCTATTGGATNTGTGTTGAATGAAATAGAG
                      ____________________________________________________________
consensus ATATTAGCTGACTTTGAAGTTTCTATTGGATNTGTGTTGAATGAAATAGAG
 
. : . : . : . : . : . :
JMFS142F06+ GTTTGAACCTTCTGCTTCGCACTGGAAGGACTATTTATGGAAGTTCTACCCCCATTTTCA
                      ____________________________________________________________
consensus GTTTGAACCTTCTGCTTCGCACTGGAAGGACTATTTATGGAAGTTCTACCCCCATTTTCA
 
. : . : . : . : . : . :
JMFS142F06+ TAATCAGAAGCTTGAGGGCTCAAAAGATGTGAATCAGTAGGATCATCAATATCACTGGAA
                      ____________________________________________________________
consensus TAATCAGAAGCTTGAGGGCTCAAAAGATGTGAATCAGTAGGATCATCAATATCACTGGAA
 
. : . : . : . : . : . :
JMFS142F06+ CTGTCACAGGAAGCAGTAGCAGTTGGCAAGTCCCTATCAATATCCATAGCATCTTGTCCA
                      ____________________________________________________________
consensus CTGTCACAGGAAGCAGTAGCAGTTGGCAAGTCCCTATCAATATCCATAGCATCTTGTCCA
 
. : . : . : . : . : . :
JMFS142F06+ TGTAGCTCAAGTCTTGGCTCAGGAAGAGGTAAGGTCAACAATGGTTTGAAGGCATACTCA
JMSF025F01+ GAAGAGGTAAGGTCAACAATGGTTTGAAGGCATACTCA
                      ____________________________________________________________
consensus TGTAGCTCAAGTCTTGGCTCAGGAAGAGGTAAGGTCAACAATGGTTTGAAGGCATACTCA
 
. : . : . : . : . : . :
JMFS142F06+ GTTGCTGATTTTGCTGATACATTACTTTCAGGTTCACCATGTTGGATATTAGAAAGGTGA
JMSF025F01+ GTTGCTGATTTTGCTGATACATTACTTTCAGGTTCACCATGTTGGATATTAGAAAGGTGA
                      ____________________________________________________________
consensus GTTGCTGATTTTGCTGATACATTACTTTCAGGTTCACCATGTTGGATATTAGAAAGGTGA
 
. : . : . : . : . : . :
JMFS142F06+ ACCACAGGAAGTGGAAGTGGTTGAGCACAGGGCCTGACCGGCCTGTCTACAAAGCTCTGA
JMSF025F01+ ACCACAGGAAGTGGAAGTGGTTGAGCACAGGGCCTGACCGGCCTGTCTACAAAGCTCTGA
JMFS006E08+ GTGGAAGTGGTTGAGCACAGGGCCTGACCGGCCTGTCTACAAAGCTCTGA
JMFS006E11+ GTTGAGCACAGGGCCTGACCGGCCTGTCTACAAAGCTCTGA
                      ____________________________________________________________
consensus ACCACAGGAAGTGGAAGTGGTTGAGCACAGGGCCTGACCGGCCTGTCTACAAAGCTCTGA
 
. : . : . : . : . : . :
JMFS142F06+ CAACGTGATACTGGTATTGACGTGGATGGGGATGGTGACCTAGAATGCACTCTTGTTCGA
JMSF025F01+ CAACGTGATACTGGTATTGACGTGGATGGGGATGGTGACCTAGAATGCACTCTTGTTCGA
JMFS006E08+ CAACGTGATACTGGTATTGACGTGGATGGGGATGGTGACCTAGAATGCACTCTTGTTCGA
JMFS006E11+ CAACGTGATACTGGTATTGACGTGGATGGGGATGGTGACCTAGAATGCACTCTTGTTCGA
                      ____________________________________________________________
consensus CAACGTGATACTGGTATTGACGTGGATGGGGATGGTGACCTAGAATGCACTCTTGTTCGA
 
. : . : . : . : . : . :
JMFS142F06+ GAGCCCTTCTCTGAAATATTGTCGCTACGACATCTTTGAGATGATCGTGACTTACCACTG
JMSF025F01+ GAGCCCTTCTCTGAAATATTGTCGCTACGACATCTTTGAGATGATCGTGACTTACCACTG
JMFS006E08+ GAGCCCTTCTCTGAAATATTGTCGCTACGACATCTTTGAGATGATCGTGACTTACCACTG
JMFS006E11+ GAGCCCTTCTCTGAAATATTGTCGCTACGACATCTTTGAGATGATCGTGACTTACCACTG
                      ____________________________________________________________
consensus GAGCCCTTCTCTGAAATATTGTCGCTACGACATCTTTGAGATGATCGTGACTTACCACTG
 
. : . : . : . : . : . :
JMFS142F06+ GATTTTTCTAAAAAGCCAATCTTGAATTTCCTATTTATTGTATCGATGAAACTTTCCGTA
JMSF025F01+ GATTTTTCTAAAAAGCCAATCTTGAATTTCCTATTTATTGTATCGATGAAACTTTCCGTA
JMFS006E08+ GATTTTTCTAAAAAGCCAATCTTGAATTTCCTATTTATTGTATCGATGAAACTTTCCGTA
JMFS006E11+ GATTTTTCTAAAAAGCCAATCTTGAATTTCCTATTTATTGTATCGATGAAACTTTCCGTA
                      ____________________________________________________________
consensus GATTTTTCTAAAAAGCCAATCTTGAATTTCCTATTTATTGTATCGATGAAACTTTCCGTA
 
. : . : . : . : . : . :
JMFS142F06+ GTTTTCTTCTTCTCTTCTTTTGATGAAGA
JMSF025F01+ GTTTTCTTCTTCTCTTCTTTTGATGAAGACCATCCCCACCAGGATCGCATGGTTATGAGA
JMFS006E08+ GTTTTCTTCTTCTCTTCTTTTGATGAAGACCATCCCCACCAGGATCGCATGGTTATGAGA
JMFS006E11+ GTTTTCTTCTTCTCTTCTTTTGATGAAGACCATCCCCACCAGGATCGCATGGTTATGAGA
JMSF002P24+ GCATGGTTATGAGA
                      ____________________________________________________________
consensus GTTTTCTTCTTCTCTTCTTTTGATGAAGACCATCCCCACCAGGATCGCATGGTTATGAGA
 
. : . : . : . : . : . :
JMSF025F01+ AAATCTAAATGGAACTGACAAAAGTCAATCTTTATTGTGAAATATTACGGCTTAATCTCT
JMFS006E08+ AAATCTAAATGGAACTGACAAAAGTCAATCTTTATTGTGAAATATTACGGCTTAATCTCT
JMFS006E11+ AAATCTAAATGGAACTGACAAAAGTCAATCTTTATTGTGAAATATTACGGCTTAATCTCT
JMSF002P24+ AAATCTAAATGGAACTGACAAAAGTCAATCTTTATTGTGAAATATTACGGCTTAATCTCT
                      ____________________________________________________________
consensus AAATCTAAATGGAACTGACAAAAGTCAATCTTTATTGTGAAATATTACGGCTTAATCTCT
 
. : . : . : . : . : . :
JMSF025F01+ GCCGATAGATACAAACTTCTTGGAGCTAATATAATGAGATCAGTACCAACAAGCTTTACA
JMFS006E08+ GCCGATAGATACAAACTTCTTGGAGCTAATATAATGAGATCAGTACCAACAAGCTTTACA
JMFS006E11+ GCCGATAGATACAAACTTCTTGGAGCTAATATAATGAGATCAGTACCAACAAGCTTTACA
JMSF002P24+ GCCGATAGATACAAACTTCTTGGAGCTAATATAATGAGATCAGTACCAACAAGCTTTACA
                      ____________________________________________________________
consensus GCCGATAGATACAAACTTCTTGGAGCTAATATAATGAGATCAGTACCAACAAGCTTTACA
 
. : . : . : . : . : . :
JMSF025F01+ TAGTTTACTCATTAGAGTGGCACAAAATTATCCAGCTAAGCATGTTGGCAGCAACTGATC
JMFS006E08+ TAGTTTACTCATTAGAGTGGCACAAAATTATCCAGCTAAGCATGTTGGCAGCAACTGATC
JMFS006E11+ TAGTTTACTCATTAGAGTGGCACAAAATTATCCAGCTAAGCATGTTGGCAGCAACTGATC
JMSF002P24+ TAGTTTACTCATTAGAGTGGCACAAAATTATCCAGCTAAGCATGTTGGCAGCAACTGATC
                      ____________________________________________________________
consensus TAGTTTACTCATTAGAGTGGCACAAAATTATCCAGCTAAGCATGTTGGCAGCAACTGATC
 
. : . : . : . : . : . :
JMSF025F01+ TGCAGTGCAAAAAGCTCTGTATACCTGCAGCCCAGGGATTAGCAGATAACCGGAGCTGAC
JMFS006E08+ TGCAGTGCAAAAAGCTCTGTATACCTGCAGCCCAGGGATTAGCAGATAACCGGAGCTGAC
JMFS006E11+ TGCAGTGCAAAAAGCTCTGTATACCTGCAGCCCAGGGATTAGCAGATAACCGGAGCTGAC
JMSF002P24+ TGCAGTGCAAAAAGCTCTGTATACCTGCAGCCCAGGGATTAGCAGATAACCGGAGCTGAC
                      ____________________________________________________________
consensus TGCAGTGCAAAAAGCTCTGTATACCTGCAGCCCAGGGATTAGCAGATAACCGGAGCTGAC
 
. : . : . : . : . : . :
JMSF025F01+ ACAACCGAAATGAACGAATGTGCTCCACTAC
JMFS006E08+ ACAACCGAAATGAACGAATGTGCTCCACTAC
JMFS006E11+ ACAACCGAAATGAACGAATGTGCTCCACTACAGCTTC
JMSF002P24+ ACAACCGAAATGAACGAATGTGCTCCACTACAGCTTCAGTTACTGAGAAGATGGAAGTTC
                      ____________________________________________________________
consensus ACAACCGAAATGAACGAATGTGCTCCACTACAGCTTCAGTTACTGAGAAGATGGAAGTTC