Previous Contig 004456:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS067B01Sequence618004456 (4)gb:AE005172_8902862e-23Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951
JMSF002O07Sequence225004456 (4)710011311 (4)gb:AP005885_18596677e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P065
JMSF004M15Sequence204004456 (4)357011311 (4)gb:OSJN00203_16966514e-14Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0032E06, complete seque
JMSF005F24Sequence412004456 (4)gb:AY086095_15711533e-10Arabidopsis thaliana clone 21249 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS067B01+ ACAGAAGTAAACACCTAGAGGAAAAGTGGATACCTGGG
                      ____________________________________________________________
consensus ACAGAAGTAAACACCTAGAGGAAAAGTGGATACCTGGG
 
. : . : . : . : . : . :
JMFS067B01+ TTCGTCTTCATTCTGGCGCCTTTCTGGGGCATAATCACCAGTCTCTTCATCGCTTTCGGA
                      ____________________________________________________________
consensus TTCGTCTTCATTCTGGCGCCTTTCTGGGGCATAATCACCAGTCTCTTCATCGCTTTCGGA
 
. : . : . : . : . : . :
JMFS067B01+ GCTCGAATTCGCACTGCTCCAACCTCTGCTTCCGCTTATCCGTCTAGAACTCAAGCTCTC
                      ____________________________________________________________
consensus GCTCGAATTCGCACTGCTCCAACCTCTGCTTCCGCTTATCCGTCTAGAACTCAAGCTCTC
 
. : . : . : . : . : . :
JMFS067B01+ GGGTGAACTTCGCCGCCGTCTATACTCCACAAAGACACAAACCATATGAAGCACACACTG
                      ____________________________________________________________
consensus GGGTGAACTTCGCCGCCGTCTATACTCCACAAAGACACAAACCATATGAAGCACACACTG
 
. : . : . : . : . : . :
JMFS067B01+ GCAAGCGTAGCCAATAATCCAGAGCCTGAGAGGCATCAAGGGCGACTCCTTGCGGCTCAT
                      ____________________________________________________________
consensus GCAAGCGTAGCCAATAATCCAGAGCCTGAGAGGCATCAAGGGCGACTCCTTGCGGCTCAT
 
. : . : . : . : . : . :
JMFS067B01+ AACTAACACAGCGATCGAGACTACGATGAAAGCTAAGTTCCAGATGAGATCCAGGATGAC
JMSF005F24+ ACACAGCGATCGAGANTACGATGAAAGNTAAGTTCCAGATGAGATCCAGGATGAC
                      ____________________________________________________________
consensus AACTAACACAGCGATCGAGACTACGATGAAAGCTAAGTTCCAGATGAGATCCAGGATGAC
 
. : . : . : . : . : . :
JMFS067B01+ GATAGGCTTGGAGTAGGCCCAATCGCTCTGTCTCTCCTCGATTTGCTCCGCCGCCGCCTC
JMSF005F24+ GATAGGCTTGGAGTAGGCCCAATCGCTCTGTCTCTCCTCGATTTGCTCCGCCGCCGCGTC
                      ____________________________________________________________
consensus GATAGGCTTGGAGTAGGCCCAATCGCTCTGTCTCTCCTCGATTTGCTCCGCCGCCGCGTC
 
. : . : . : . : . : . :
JMFS067B01+ GCGCACCCGCATCGACGGCTCCCGCATCATCCTCCGACTGCTGGCTCGCCGCAGGAACCG
JMSF005F24+ GCGCACCCGCATCGACGGCTCCCGCATCATCCTCCGACTGCTGGCTCGCCGCAGGAACCG
                      ____________________________________________________________
consensus GCGCACCCGCATCGACGGCTCCCGCATCATCCTCCGACTGCTGGCTCGCCGCAGGAACCG
 
. : . : . : . : . : . :
JMFS067B01+ AGCCGCCCCTCTTAGGCTCGGAGAATTGCGCATGAATCGCCGGCTACGGAAGATCTGGTC
JMSF005F24+ AGCCGCCCCCCTTAGGCTCGGAGAATTGCGCATGAATCGCCGGCTACGGAAGATCTGGTC
JMSF004M15+ GAATCGCCGGCTACGGAAGATCTGGTC
JMSF002O07+ GCTCGGAGAATTGCGCATGAATCGCCGGCTACGGAAGATCTGGTC
                      ____________________________________________________________
consensus AGCCGCCCCTCTTAGGCTCGGAGAATTGCGCATGAATCGCCGGCTACGGAAGATCTGGTC
 
. : . : . : . : . : . :
JMFS067B01+ GTTAAGCAAAGGCGTCGTGTCCACTCCTCCTCCGCCGCTGCCGCCGCCATCGACGGAACC
JMSF005F24+ GTTAAGCAAAGGCGTCGTGTCCACTCCTCCTCCGCCGCTGCCGCCGCCATCGACGGAACC
JMSF004M15+ GTTAAGCAAAGGCGTCGTGTCCACTCCTCNTCCGCCGCTGCCGCCGCCATCGACGGAACC
JMSF002O07+ GTTAAGCAAAGGCGTCGTGTCCACTCCTCCTCCGCCGCTGCCGCCGCCATCGACGGAACC
                      ____________________________________________________________
consensus GTTAAGCAAAGGCGTCGTGTCCACTCCTCCTCCGCCGCTGCCGCCGCCATCGACGGAACC
 
. : . : . : . : . : . :
JMFS067B01+ GGAGTTAGCGTCTGCGCCGGAAGTTTCCTCGTTCGGATCC
JMSF005F24+ GGAGTTAGCGTCTGCGCCGGAAGTTTCCTCGTTCGGATCCCTAGCCGTCGACATCTCTGC
JMSF004M15+ GGAGTTAGCGTCTGCGCCGGAAGTTTCCTCGTTCGGATCCCTAGCCGTCGACATCTCTGC
JMSF002O07+ GGAGTTAGCGTCTGCGCCGGAAGTTTCCTCGTTCGGATCCCTAGCCGTCGACATCTCTGC
                      ____________________________________________________________
consensus GGAGTTAGCGTCTGCGCCGGAAGTTTCCTCGTTCGGATCCCTAGCCGTCGACATCTCTGC
 
. : . : . : . : . : . :
JMSF005F24+ CGGAAAATTACAACAATTTCTCCTTAGGTACACAGAAGGAAGATAGGAAGAAG
JMSF004M15+ CGGAAAATTACAACAATTTCTCCTTAGGTACACAGAAGGAAGATAGGAAGAAG
JMSF002O07+ CGGAAAATTACAACAATTTCTCCTTAGGTACACAGAAGGAAGATAGGAAGAAGCTCACCC
                      ____________________________________________________________
consensus CGGAAAATTACAACAATTTCTCCTTAGGTACACAGAAGGAAGATAGGAAGAAGCTCACCC