Previous Contig 004450:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007I12Sequence631004450 (21)gb:STU488941_17230892e-83Solanum tuberosum mRNA for putative mitochondrial NAD-dependent malate dehydroge791004450 (21)sp|P17783|MDHM_CITLA6e-67Malate dehydrogenase, mitochondrial precursor (EC 1.1.1.37).>pir|S10162|DEPUMW m
JMFF019H11Sequence566004450 (21)gb:STU488941_17230893e-72Solanum tuberosum mRNA for putative mitochondrial NAD-dependent malate dehydroge720004450 (21)sp|P17783|MDHM_CITLA2e-71Malate dehydrogenase, mitochondrial precursor (EC 1.1.1.37).>pir|S10162|DEPUMW m
JMFF020D09Sequence488004450 (21)gb:STU488941_17230891e-57Solanum tuberosum mRNA for putative mitochondrial NAD-dependent malate dehydroge722004450 (21)sp|P17783|MDHM_CITLA3e-68Malate dehydrogenase, mitochondrial precursor (EC 1.1.1.37).>pir|S10162|DEPUMW m
JMFF021C21Sequence518004450 (21)gb:STU488941_17230897e-58Solanum tuberosum mRNA for putative mitochondrial NAD-dependent malate dehydroge
JMFF026D18Sequence542004450 (21)gb:STU488941_17230895e-68Solanum tuberosum mRNA for putative mitochondrial NAD-dependent malate dehydroge748004450 (21)sp|P17783|MDHM_CITLA7e-59Malate dehydrogenase, mitochondrial precursor (EC 1.1.1.37).>pir|S10162|DEPUMW m
JMFF029A12Sequence574004450 (21)gb:STU488941_17230896e-74Solanum tuberosum mRNA for putative mitochondrial NAD-dependent malate dehydroge718004450 (21)sp|P17783|MDHM_CITLA1e-64Malate dehydrogenase, mitochondrial precursor (EC 1.1.1.37).>pir|S10162|DEPUMW m
JMFF033J05Sequence523005475 (6)sp|Q9ATF5|RL1X_CASSA2e-6360S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei798004450 (21)sp|P17783|MDHM_CITLA1e-66Malate dehydrogenase, mitochondrial precursor (EC 1.1.1.37).>pir|S10162|DEPUMW m
JMFF033J06Sequence139005475 (6)gb:AY088351_15733714e-17Arabidopsis thaliana clone 5961 mRNA, complete sequence.720004450 (21)gb:AY045592_15611832e-53Arabidopsis thaliana AT3g15020/K15M2_16 mRNA, complete cds.>gb:AY093788_1575440
JMFN008P05Sequence515004450 (21)gb:AC098832_17368927e-37Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08, complete s
JMFN013I15Sequence634004450 (21)gb:AF180335_17748051e-95Glycine max malate dehydrogenase (Mdh1) gene, complete cds; nuclear gene for mit
JMFN019C02Sequence615004450 (21)sp|P17783|MDHM_CITLA7e-55Malate dehydrogenase, mitochondrial precursor (EC 1.1.1.37).>pir|S10162|DEPUMW m
JMSF002N18Sequence280004450 (21)gb:STU488941_17230899e-13Solanum tuberosum mRNA for putative mitochondrial NAD-dependent malate dehydroge717004450 (21)sp|P17783|MDHM_CITLA6e-70Malate dehydrogenase, mitochondrial precursor (EC 1.1.1.37).>pir|S10162|DEPUMW m
JMSF008K17Sequence408004450 (21)gb:STU488941_17230896e-43Solanum tuberosum mRNA for putative mitochondrial NAD-dependent malate dehydroge701004729 (23)gb:AF108883_17686401e-74Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMSF041E13Sequence818004450 (21)gb:STU488941_1723089e-107Solanum tuberosum mRNA for putative mitochondrial NAD-dependent malate dehydroge607004450 (21)gb:AC098832_17368921e-40Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041E13- GTTCAGGGTTTTCATCACTAACAATTCAGNGGTAAACA
rJMFF026D18- ATTCAGTGGTAAACA
rJMFF007I12- CTAACAATTCAGTGGTAAACA
rJMFF033J06- CTAACAATTCAGTGGTAAACA
rJMFF033J05- CTAACAATTCAGTGGTAAACA
                      ____________________________________________________________
consensus GTTCAGGGTTTTCATCACTAACAATTCAGTGGTAAACA
 
. : . : . : . : . : . :
rJMSF041E13- AGGACAAGTACAAAGTAGGCAAAAGACAAATTATATATCANGATCAGTTCATTCCACAAA
rJMFF026D18- AGGACAAGTACAAAGTAGGCAAAAGACAAATTATATATCATGATCAGTTCATTCCACAAA
rJMFF029A12- TGATCAGTTCATTCCACAAA
JMFN008P05+ AGGCAAAAGTCAAATTATATATCATGATCAGTTCATTCCACTAA
rJMFF007I12- AGGACAAGTACAAAGTAGGCAAAAGACAAATTATATATCATGATCAGTTCATTCCACAAA
rJMFF033J06- AGGACAAGTACAAAGTAGGCAAAAGACAAATTATATATCATGATCAGTTCATTCCACAAA
rJMFF033J05- AGGACAAGTACAAAGTAGGCAAAAGACAAATTATATATCATGATCAGTTCATTCCACAAA
rJMFF020D09- AGTTCATTCCACAAA
                      ____________________________________________________________
consensus AGGACAAGTACAAAGTAGGCAAAAGACAAATTATATATCATGATCAGTTCATTCCACAAA
 
. : . : . : . : . : . :
rJMSF041E13- TTATTTGAACCA-GTATTTCATCTATCCTTAGTCNGCTTCAATTTTAAATAGCTAAATCT
rJMFF026D18- TTATTTGAACCA-GTATTTCATCTATCCTTAGTCTGCTTCAATTTTAAATAGCTAAATCT
rJMFF029A12- TTATTTGAACCA-GTATTTCATCTATCCTTAGTCTGCTTCAATTTTAAATAGCTAAATCT
JMFN019C02+ ACCA-GTATTTCATCTATCCTTAGTCTGCTTCAATTTTAAATAGCTAAATCT
JMFN008P05+ TTATTTGAACCA-GTAGTTCATCTATCCTTAGTGTGCTTCAATTTTAAATAGCTAAATCT
rJMFF007I12- TTATTTGAACCA-GTATTTCATCTATCCTTAGTCTGCTTCAATTTTAAATAGCTAAATCT
rJMFF033J06- TTATTTGAACCA-GTATTTCATCTATCCTTAGTCTGCTTCAATTTTAAATAGCTAAATCT
rJMFF033J05- TTATTTGAACCA-GTATTTCATCTATCCTTAGTCTGCTTCAATTTTAAATAGCTAAATCT
rJMFF020D09- TTATTTGAACCA-GTATTTCATCTATCCTTAGTCTGCTTCAATTTTAAATAGCTAAATCT
rJMSF002N18- TTATTTGAACCAGGTATTTCATCTATCCTTAGTCTGCTTCAATTTTAAATAGCTAAATCT
rJMFF019H11- TTGAACCA-GTATTTCATCTATCCTTAGTCTGCTTCAATTTTAAATAGCTAAATCT
                      ____________________________________________________________
consensus TTATTTGAACCA-GTATTTCATCTATCCTTAGTCTGCTTCAATTTTAAATAGCTAAATCT
 
. : . : . : . : . : . :
rJMSF041E13- AANAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
rJMFF026D18- AAGAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
rJMFF029A12- AAGAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
JMFN019C02+ AAGAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
JMFN008P05+ AAGAAATTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTTGAAAATAGTATTCAAA
rJMFF007I12- AAGAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
rJMFF033J06- AAGAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
rJMFF033J05- AAGAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
rJMFF020D09- AAGAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
rJMSF002N18- AAGAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
rJMFF019H11- AAGAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
                      ____________________________________________________________
consensus AAGAAACTGGCAGTCTCTAAAATCCGAGTAGACAACAATTGCTCGAAATTATTATTCAAA
 
. : . : . : . : . : . :
rJMSF041E13- ATTGNGAATCACTCAAANGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACNGGA
rJMFF026D18- ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
rJMFF029A12- ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
JMFN019C02+ ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
JMFN008P05+ ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
rJMFF007I12- ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
rJMFF033J06- ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
rJMFF033J05- ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
rJMFF020D09- ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
rJMSF002N18- ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
rJMFF019H11- ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
                      ____________________________________________________________
consensus ATTGTGAATCACTCAAATGGCAAAAGGGGAGAATTTCTTAGTTCTGGTTGGCAAACTGGA
 
. : . : . : . : . : . :
rJMSF041E13- TTCCCTTCTCAATAGAANATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTCGA
rJMFF026D18- TTCCCTTCTCAATAGAAGATTTCAGCTCAGGCTTAAGTTCCTCTAGCCCTTCCTTCTCGA
rJMFF029A12- TTCCCTTCTCAATAGAAGATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTCGA
JMFN019C02+ TTCCCTTCTCAATAGAAGATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTCGA
JMFN008P05+ TTCCCTTCTCAATACAAGATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTAGA
rJMFF007I12- TTCCCTTCTCAATAGAAGATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTCGA
rJMFF033J06- TTCCCTTCTCAATAGAAGATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTCGA
rJMFF033J05- TTCCCTTCTCAATAGAAGATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTCGA
rJMFF020D09- TTCCCTTCTCAATAGAAGATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTCGA
rJMSF002N18- TTCCCTTCTCAATAGAAGATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTCGA
rJMFF019H11- TTCCCTTCTCAATAGAAGATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTCGA
                      ____________________________________________________________
consensus TTCCCTTCTCAATAGAAGATTTCAGCTCAGGCTTAAGTTTCTCTAGCCCTTCCTTCTCGA
 
. : . : . : . : . : . :
rJMSF041E13- AGTCTGNGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
rJMFF026D18- AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
rJMFF029A12- AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
JMFN019C02+ AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
JMFN008P05+ AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTGCACGCCATTTTTGCCAAGTCTCACCT
rJMFF007I12- AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
rJMFF033J06- AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
rJMFF033J05- AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
rJMFF020D09- AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
rJMSF002N18- AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
rJMFF019H11- AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
                      ____________________________________________________________
consensus AGTCTGTGAGAGAACCCAACCCTAGCACTTCCTCCACGCCATTTTTGCCAAGTCTCACCT
 
. : . : . : . : . : . :
rJMSF041E13- TGGATGCAAAGAAAGGAAGCTCAGNGACAGTTGACTGAACAAAAGAACATTCCACAACAT
rJMFF026D18- TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGACTGAACAAAAGAACATTCCACAACAT
rJMFF029A12- TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGACTGAACAAAAGAACATTCCACAACAT
JMFN019C02+ TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGACTGAACAAAAGAACATTCCACAACAT
JMFN008P05+ TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGTGTGAACAAAAGAACATTCCGCAACAT
rJMFF007I12- TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGACTGAACAAAAGAACATTCCACAACAT
rJMFF033J06- TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGACTGAACAAAAGAACATTCCACAACAC
rJMFF033J05- TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGACTGAACAAAAGAACATTCCACAACAC
rJMFF020D09- TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGACTGAACAAAAGAACATTCCACAACAT
rJMSF002N18- TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGACTGAACAAAAGAACATTCCACAACAT
rJMFF019H11- TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGACTGAACAAAAGAACATTCCACAACAT
                      ____________________________________________________________
consensus TGGATGCAAAGAAAGGAAGCTCAGTGACAGTTGACTGAACAAAAGAACATTCCACAACAT
 
. : . : . : . : . : . :
rJMSF041E13- CNGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
rJMFF026D18- CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
rJMFF029A12- CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
JMFN019C02+ CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
JMFN008P05+ CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGTGTATGCCA
rJMFF007I12- CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
rJMFF033J06- CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
rJMFF033J05- CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
rJMFF020D09- CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
rJMSF002N18- CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
rJMFF019H11- CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
                      ____________________________________________________________
consensus CAGGAACACCATTGAGTCCTTTCAAGCAAGCATCTGCAAATATGGCCCCGGCGTATGCCA
 
. : . : . : . : . : . :
rJMSF041E13- TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACCTCCGTCTT
rJMFF026D18- TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACCTCCGTCTT
rJMFF029A12- TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTACCACAACTTCCGTACCTCCGTCTT
JMFN019C02+ TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACCTCCGTCTT
JMFN008P05+ TCGATAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACC
rJMFF007I12- TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACCTCCGTCTT
rJMFF033J06- TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACCTCCGTCTT
rJMFF033J05- TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACCTCCGTCTT
rJMFF020D09- TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACCTCCGTCTT
rJMSF002N18- TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACCTCCGTCTT
rJMFF019H11- TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACCTCCGTCTT
JMFN013I15+ CGTACCTCCGTCTT
JMSF041E13+ TTCCACAACTTCCGTACCTCCGTCTT
                      ____________________________________________________________
consensus TCGAGAGGGTGGCTGAACCCTTTCCAGCCTTAGCTTCCACAACTTCCGTACCTCCGTCTT
 
. : . : . : . : . : . :
rJMSF041E13- GGGTTCTTTTTGTTAGTCCAACAATCACAT
rJMFF026D18- GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTTCGCTTGTGGAGTAGCTT
rJMFF029A12- GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTTCGCTTGTGGAGTAGCTT
JMFN019C02+ GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTTCGCTTGTGGAGTAGCTT
rJMFF007I12- GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTTCGCTTGTGGAGTAGCTT
rJMFF033J06- GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTCCGCTTGTGGAGTAGCTT
rJMFF033J05- GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTCCGCTTGTGGAGTAGCTT
rJMFF020D09- GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTTCGCTTGTGGAGTAGCTT
rJMSF002N18- GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTTCGCTTGTGGAGTAGCTT
rJMFF019H11- GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTTCGCTTGTGGAGTAGCTT
JMFN013I15+ GGGTTCTNTTTGTTAGTCCAACAATCACATCATGTGCTAAGTTCGCTTGTGGAGTAGCTT
JMSF041E13+ GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTTCGCTTGTGGAGTAGCTT
                      ____________________________________________________________
consensus GGGTTCTTTTTGTTAGTCCAACAATCACATCATGTGCTAAGTTCGCTTGTGGAGTAGCTT
 
. : . : . : . : . : . :
rJMFF026D18- GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
rJMFF029A12- GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
JMFN019C02+ GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
rJMFF007I12- GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
rJMFF033J06- GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
rJMFF033J05- GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
rJMFF020D09- GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
rJMSF002N18- GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
rJMFF019H11- GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
JMFN013I15+ GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
JMSF041E13+ GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
                      ____________________________________________________________
consensus GAGAAAACAATGGGAGAATTGTTATGCCTGCATGACCACCAATGACAGGTACATTGACCT
 
. : . : . : . : . : . :
rJMFF026D18- CAGCTACGTTAACATTGGCTTTTCCAGCATAGAAAGTCTTGGCCCGGACAACATCAAGT
rJMFF029A12- CAGCTACGTTAACATTGGCTTTTCCAGCATAGAAAGTCTTGGCCCGGACAACATCAAGTG
JMFN019C02+ CAGCTACGTTAACATTGGCTTTTC
rJMFF007I12- CAGCTACGTTAACATTGGCTTTTCCAGCATAGAAAGTCTTGGCCCGGACAACATCAAGTG
rJMFF033J06- CAGCTACGTTAACATTGGCTTTTCCAGCATAGA
rJMFF033J05- CAGCTACGTTAACATTGGCTTTTCCAGCATAGAAAGTCTTGGCCCGGACAACATCAAGTG
rJMFF020D09- CAGCTACGTTAACATTGGCTTTTCCAGCATAGAAAGTCTTGGCCCGGACAACATCAAGTG
rJMSF002N18- CAGCTACGTTAACATTGGCTTTTCCAGCATAGAAAGTCTTGGCCCGGACAACATCAAGTG
rJMFF019H11- CAGCTACGTTAACATTGGCTTTTCCAGCATAGAAAGTCTTGGCCCGGACAACATCAAGTG
JMFN013I15+ CAGCTACGTTAACATTGGCTTTTCCAGCATAGAAAGTCTTGGCCCGGACAACATCAAGTG
JMSF041E13+ CAGCTACGTTAACATTGGCTTTTCCAGCATAGAAAGTCTTGGCCCGGACAACATCAAGTG
JMFF007I12+ ACAACATCAAGTG
                      ____________________________________________________________
consensus CAGCTACGTTAACATTGGCTTTTCCAGCATAGAAAGTCTTGGCCCGGACAACATCAAGTG
 
. : . : . : . : . : . :
rJMFF029A12- TTGTGANCCCAAAGAGTCTCTTTTCATCATATGNTCCAG
rJMFF007I12- TTGTGACCCCAAAGAGTCTCTTTTCATCATATGTTCCAGC
rJMFF033J05- TTGTGACCCCAAAGAGTCTCTTTTCATCATATGTTCCAGCCTTTTTAA
rJMFF020D09- TTGTGACCCCAAAGAGTCTCTTTTCATCATATGTTCCAGCCTTTTTAA
rJMSF002N18- TTGTGACCCCAAAGAGTCTCTTTTCATCATATGTTCCAGCCTTTTTAAAGACCTCAG
rJMFF019H11- TTGTGACCCCAAAGAGTCTCTTTTCATCATATGTTCCAGCCTTTTTAAAGACCTCAGCAG
JMFN013I15+ TTGTGACCCCAAAGAGTCTCTTTTCATCATATGTTCCAGCCTTTTTAAAGACCTCAGCAG
JMSF041E13+ TTGTGACCCCAAAGAGTCTCTTTTCATCATATGTTCCAGCCTTTTTAAAGACCTCAGCAG
JMFF029A12+ TTTAAAGACCTCAGCAG
JMFF019H11+ ACCTCAGCAG
JMFF007I12+ TTGTGACCCCAAAGAGTCTCTTTTCATCATATGTTCCAGCCTTTTTAAAGACCTCAGCAG
                      ____________________________________________________________
consensus TTGTGACCCCAAAGAGTCTCTTTTCATCATATGTTCCAGCCTTTTTAAAGACCTCAGCAG
 
. : . : . : . : . : . :
rJMFF019H11- CAATT
JMFN013I15+ CAATTGGGACAGTGGAGTTTACAGGGTTGCTAATCATATTGACAAGAGCATGTGGGCAAT
JMSF041E13+ CAATTGGGACAGTGGAGTTTACAGGGTTGCTAATCATATTGACAAGAGCATGTGGGCAAT
JMFF029A12+ CAATTGGGACAGTGGAGTTTACAGGGTTGCTAATCATATTGACAAGAGCATGTGGGCAAT
JMFF019H11+ CAATTGGGACAGTGGAGTTTACAGGGTTGCTAATCATATTGACAAGAGCATGTGGGCAAT
JMFF026D18+ GTTTACAGGGTTGCTAATCATATTGACAAGAGCATGTGGGCAAT
JMFF021C21+ ACAAGAGCATGTGGGCAAT
JMFF007I12+ CAATTGGGACAGTGGAGTTTACAGGGTTGCTAATCATATTGACAAGAGCATGTGGGCAAT
                      ____________________________________________________________
consensus CAATTGGGACAGTGGAGTTTACAGGGTTGCTAATCATATTGACAAGAGCATGTGGGCAAT
 
. : . : . : . : . : . :
JMFN013I15+ ACTTGGCAATGG-CAGCAGAGAGTGACTTCACAATGCCAGCATTGATGTTGAAGAGATCA
JMSF041E13+ ACTTGGCAATGG-CAGCAGAGAGTGACTTCACAATGCCAGCATTGATGTTGAAGAGATCA
JMFF029A12+ ACTTGGCAATGG-CAGCAGAGAGTGACTTCACAATGCCAGCATTGATGTTGAAGAGATCA
JMFF019H11+ ACTTGGCAATGG-CAGCAGAGAGTGACTTCACAATGCCAGCATTGATGTTGAAGAGATCA
JMFF026D18+ ACTTGGCAATGG-CAGCAGAGAGTGACTTCACAATGCCAGCATTGATGTTGAAGAGATCA
JMFF021C21+ ACTTGGCAATGGCCAGCAGAGAGTGACTTCACAATGCCAGCATTGATGTTGAAGAGATCA
JMFF020D09+ TGG-CAGCAGAGAGTGACTTCACAATGCCAGCATTGATGTTGAAGAGATCA
JMFF007I12+ ACTTGGCAATGG-CAGCAGAGAGTGACTTCACAATGCCAGCATTGATGTTGAAGAGATCA
                      ____________________________________________________________
consensus ACTTGGCAATGG-CAGCAGAGAGTGACTTCACAATGCCAGCATTGATGTTGAAGAGATCA
 
. : . : . : . : . : . :
JMFN013I15+ TCACGGGTCATTCCAGGCTTCCTGGGAACACCAGCTGGAATGATGACAACATCAGCTCCC
JMSF041E13+ TCACGGGTCATTCCAGGCTTCCTGGGAACACCAGCTGGAATGATGACAACATCAGCTCCC
JMFF029A12+ TCACGGGTCATTCCAGGCTTCCTGGGAACACCAGCTGGAATGATGACAACATCAGCTCCC
JMFF019H11+ TCACGGGTCATTCCAGGCTTCCTGGGAACACCAGCTGGAATGATGACAACATCAGCTCCC
JMFF026D18+ TCACGGGTCATTCCAGGCTTCCTGGGAACACCAGCTGGAATGATGACAACATCAGCTCCC
JMFF021C21+ TCACGGGTCATTCCAGGCTTCCTGGGAACACCAGCTGGAATGATGACAACATCAGCTCCC
JMFF020D09+ TCACGGGTCATTCCAGGCTTCCTGGGAACACCAGCTGGAATGATGACAACATCAGCTCCC
JMSF008K17+ CAGCTGGAATGATGACAACATCAGCTCCC
JMFF007I12+ TCACGGGTCATTCCAGGCTTCCTGGGAACACCAGCTGGAATGATGACAACATCAGCTCCC
                      ____________________________________________________________
consensus TCACGGGTCATTCCAGGCTTCCTGGGAACACCAGCTGGAATGATGACAACATCAGCTCCC
 
. : . : . : . : . : . :
JMFN013I15+ TCCAGAGCCTTGCCAAGGTTTTCATCTCCCGAAAACCCAACCACCTCAGATCTGGTATTG
JMSF041E13+ TCCAGAGCCTTGCCAAGGTTTTCATCTCCCGAAAACCCAACCACCTCAGATCTGGTATTG
JMFF029A12+ TCCAGAGCCTTGCCAAGGTTTTCATCTCCCGAAAACCCAACCACCTCAGATCTGGTATTG
JMFF019H11+ TCCAGAGCCTTGCCAAGGTTTTCATCTCCCGAAAACCCAACCACCTCAGATCTGGTATTG
JMFF026D18+ TCCAGAGCCTTGCCAAGGTTTTCATCTCCCGAAAACCCAACCACCTCAGATCTGGTATTG
JMFF021C21+ TCCAGAGCCTTGCCAAGGTTTTCATCTCCCGAAAACCCAACCACCTCAGATCTGGTATTG
JMFF020D09+ TCCAGAGCCTTGCCAAGGTTTTCATCTCCCGAAAACCCAACCACCTCAGATCTGGTATTG
JMSF008K17+ TCCAGAGCCTTGCCAAGGTTTTCATCTCCCGAAAACCCAACCACCTCAGATCTGGTATTG
JMFF007I12+ TCCAGAGCCTTGCCAAGGTTTTCATCTCCCGAAAACCCAACCACCTCAGATCTGGTATTG
                      ____________________________________________________________
consensus TCCAGAGCCTTGCCAAGGTTTTCATCTCCCGAAAACCCAACCACCTCAGATCTGGTATTG
 
. : . : . : . : . : . :
JMFN013I15+ ATGTGGCTGACATCGGCAGCGACGCCAGGAGTCCCGGCGATATCGAAAAGGGAGAGGTGA
JMSF041E13+ ATGTGGCTGACATCGGCAGCGACGCCAGGAGTCCCGGCGATATCGAAAAGGGAGAGGTGA
JMFF029A12+ ATGTGGCTGACATCGGCAGCGACGCCAGGAGTCCCGGCGATATCGAAAAGGGAGAGGTGA
JMFF019H11+ ATGTGGCTGACATCGGCAGCGACGCCAGGAGTCCCGGCGATATCGAAAAGGGAGAGGTGA
JMFF026D18+ ATGTGGCTGACATCGGCAGCGACGCCAGGAGTCCCGGCGATATCGAAAAGGGAGAGGTGA
JMFF021C21+ ATGTGGCTGACATCGGCAGCGACGCCAGGAGTCCCGGCGATATCGAAAAGGGAGAGGTGA
JMFF020D09+ ATGTGGCTGACATCGGCAGCGACGCCAGGAGTCCCGGCGATATCGAAAAGGGAGAGGTGA
JMSF008K17+ ATGTGGCTGACATCGGCAGCGACGCCAGGAGTCCCGGCGATATCGAAAAGGGAGAGGTGA
JMFF007I12+ ATGTGGCTGACATCGGCAGCGACGCCAGGAGTCCCGGCGATATCGAAAAGGGAGAGGTGA
                      ____________________________________________________________
consensus ATGTGGCTGACATCGGCAGCGACGCCAGGAGTCCCGGCGATATCGAAAAGGGAGAGGTGA
 
. : . : . : . : . : . :
JMFN013I15+ GATACGAGAGGATTGAGCTTCATGAGCAGAGAGAGCGGCTGGCCGATCCCTCCGGCGGCT
JMSF041E13+ GATACGAGAGGATTGAGCTTCATGAGCAGAGAGAGCGGCTGGCCGATCCCTCCGGCGGCT
JMFF029A12+ GATACGAGAGGATTGAGCTTCATGAGCAGAGAGAGCGGCTGGCCGATCCCTCCGGCGGCT
JMFF019H11+ GATACGAGAGGATTGAGCTTCATGAGCAGAGAGAGCGGCTGGCCGATCCCTCCGGCGGCT
JMFF026D18+ GATACGAGAGGATTGAGCTTCATGAGCAGAGAGAGCGGCTGGCCGATCCCTCCGGCGGCT
JMFF021C21+ GATACGAGAGGATTGAGCTTCATGAGCAGAGAGAGCGGCTGGCCGATCCCTCCGGCGGCT
JMFF020D09+ GATACGAGAGGATTGAGCTTCATGAGCAGAGAGAGCGGCTGGCCGATCCCTCCGGCGGCT
JMSF008K17+ GATACGAGAGGATTGAGCTTCATGAGCAGAGAGAGCGGCTGGCCGATCCCTCCGGCGGCT
JMFF007I12+ GATACGAGAGGATTGAGCTTCATGAGCAGAGAGAGCGGCTGGCCGATCCCTCCGGCGGCT
JMSF002N18+ CATGAGCAGAGAGAGCGGCTGGCCGATCCNTCCGGCGGCT
                      ____________________________________________________________
consensus GATACGAGAGGATTGAGCTTCATGAGCAGAGAGAGCGGCTGGCCGATCCCTCCGGCGGCT
 
. : . : . : . : . : . :
JMFN013I15+ CCCAAGATGGCGACCTTCCGC
JMSF041E13+ CCCAAGATGGCGACCTTCCGCTCGGGGGCGGACCCCGACGCAAACCCGCGGCGCGCGACG
JMFF029A12+ CCCAAGATGGCGACCTTCCGCTCGGGGGCGGACCCCGACGCAAACCCGCGGCGCGCGACG
JMFF019H11+ CCCAAGATGGCGACCTTCCGCTCGGGGGCGGACCCCGACGCAAACCCGCGGCGCGCGACG
JMFF026D18+ CCCAAGATGGCGACCTTCCGCTCGGGGGCGGACCCCGACGCAAACCCGCGGCGCGCGACG
JMFF021C21+ CCCAAGATGGCGACCTTCCGCTCGGGGGCGGACCCCGACGCAAACCCGCGGCGCGCGACG
JMFF020D09+ CCCAAGATGGCGACCTTCCGCTCGGGGGCGGACCCCGACGCAAACCCGCGGCGCGCGACG
JMSF008K17+ CCCAAGATGGCGACCTTCCGCTCGGGGGCGGACCCCGACGCAAACCCGCGGCGCGCGACG
JMFF007I12+ CCCAAGATGGCGACCTTCCGCTCGGGGGCGGACCCCGACGCAAACCCGCGGCGCGCGACG
JMSF002N18+ CCCAAGATGGCGACCTTCCGCTCGGGGGCGGACCCCGACGCAAACCCGCGGCGCGCGACG
                      ____________________________________________________________
consensus CCCAAGATGGCGACCTTCCGCTCGGGGGCGGACCCCGACGCAAACCCGCGGCGCGCGACG
 
. : . : . : . : . : . :
JMSF041E13+ CGAGAACCATCGGAAACAGAGTTTTTGAGAAGGGATCTCAACATTGATGATCTCATTTCT
JMFF029A12+ CGAGAACCATCGGAAACAGAGTTTTTGAGAAGGGATCTCAACATTGATGATCTCATTTCT
JMFF019H11+ CGAGAACCATCGGAAACAGAGTTTTTGAGAAGGGATCTCAACATTGATGATCTCATTTCT
JMFF026D18+ CGAGAACCATCGGAAACAGAGTTTTTGAGAAGGGATCTCAACATTGATGATCTCATTTCT
JMFF021C21+ CGAGAACCATCGGAAACAGAGTTTTTGAGAAGGGATCTCAACATTGATGATCTCATTTCT
JMFF020D09+ CGAGAACCATCGGAAACAGAGTTTTTGAGAAGGGATCTCAACATTGATGATCTCATTTCT
JMSF008K17+ CGAGAACCATCGGAAACAGAGTTTTTGAGAAGGGATCTCAACATTGATGATCTCATTTCT
JMFF007I12+ CGAGAACCATCGGAAACAGAGTTTTTGAGAAGGGATCTCAACATTGATGATCTCATTTCT
JMSF002N18+ CGAGAACCATCGGAAACAGAGTTTTTGAGAAGGGATCTCAACATTGATGATCTCATTTCT
                      ____________________________________________________________
consensus CGAGAACCATCGGAAACAGAGTTTTTGAGAAGGGATCTCAACATTGATGATCTCATTTCT
 
. : . : . : . : . : . :
JMSF041E13+ ATCTCAAGCGATCTTAGAAATGGAGTGAAGAAAATGAAAGAGGTCTCGACTGTTCTTGGC
JMFF029A12+ ATCTCAAGCGATCTTAGAAATGGAGTGAAGAAAATGAAAGAGGTCTCGACTGTTCTTGGC
JMFF019H11+ ATCTCAAGCGATCTTAGAAATGGAGTGAAGAAAATGAAAGAGGTCTCGACTGTTCTTGGC
JMFF026D18+ ATCTCAAGCGATCTTAGAAATGGAGTGAAGAAAATGAAAGAGGTCTCGACTGTTCTTGGC
JMFF021C21+ ATCTCAAGCGATCTTAGAAATGGAGTGAAGAAAATGAAAGAGGTCTCGACTGTTCTTGGC
JMFF020D09+ ATCTCAAGCGATCTTAGAAATGGAGTGAAGAAAATGAAAGAGGTCTCGACTGTTCTTGGC
JMSF008K17+ ATCTCAAGCGATCTTAGAAATGGAGTGAAGAAAATGAAAGAGGTCTCGACTGTTCTTGGC
JMFF007I12+ ATCTCAAGCGATCTTAGAAATGGAGTGAAGAAAATGAAAGAGGTCTCGACTGTTCTTGGC
JMSF002N18+ ATCTCAAGCGATCTTAGAAATGGAGTGAAGAAAATGAAAGAGGTCTCGACTGTTCTTGGC
                      ____________________________________________________________
consensus ATCTCAAGCGATCTTAGAAATGGAGTGAAGAAAATGAAAGAGGTCTCGACTGTTCTTGGC
 
. : . : . : . : . : . :
JMSF041E13+ GAAAGTAGAGGT
JMFF029A12+ GAAAGTAGAGGTGAGAAG
JMFF019H11+ GAAAGTAGAGGTGGGA
JMFF026D18+ GAAAGTAGAGGTGGGAAG
JMFF021C21+ GAAAGTAGAGGTGGGAAG
JMFF020D09+ GAAAGTAGAGGTGGGAAG
JMSF008K17+ GAAAGTAGAGGTGGGAAG
JMFF007I12+ GAAAGTAGAGGTGGGAAG
JMSF002N18+ GAAAGTAGAGGTGGGAAGAGGGCTTTAGTGTACAACTGTTGTGTATTTATTGTGGTGGCC
                      ____________________________________________________________
consensus GAAAGTAGAGGTGGGAAGAGGGCTTTAGTGTACAACTGTTGTGTATTTATTGTGGTGGCC