Previous Contig 004447:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002M22Sequence326004447 (4)722010572 (5)gb:AY048286_15617472e-35Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851
JMSF006N17Sequence299004447 (4)
JMSF006O17Sequence264004447 (4)
JMSF029A01Sequence549004447 (4)gb:AY048286_15617471e-05Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851724010572 (5)gb:AY048286_15617477e-37Arabidopsis thaliana AT4g36960/C7A10_400 mRNA, complete cds.>gb:BT000573_1634851

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029A01+ TTACAATAC
                      ____________________________________________________________
consensus TTACAATAC
 
. : . : . : . : . : . :
JMSF029A01+ AGTNNTCCAATTCCCCAAATTNGCACATGTATTNTNTTAAGCCCTCGGTATCAATGTCCC
                      ____________________________________________________________
consensus AGTNNTCCAATTCCCCAAATTNGCACATGTATTNTNTTAAGCCCTCGGTATCAATGTCCC
 
. : . : . : . : . : . :
JMSF029A01+ AAGGGATACCCAAAACAACAAGCTTCNTATCCGACATGGTAAAAGGGGGCGCAAAGACAA
                      ____________________________________________________________
consensus AAGGGATACCCAAAACAACAAGCTTCNTATCCGACATGGTAAAAGGGGGCGCAAAGACAA
 
. : . : . : . : . : . :
JMSF029A01+ ATCTAGCTGCAGAGATAAAAAATCGNTCGAGACACACACAATTTNTNTCCTCTGTTCCTC
                      ____________________________________________________________
consensus ATCTAGCTGCAGAGATAAAAAATCGNTCGAGACACACACAATTTNTNTCCTCTGTTCCTC
 
. : . : . : . : . : . :
JMSF029A01+ TTGCGCTCTNGCGATCCCACCACCTCCCTCTCTACAAATCAAGCGCTCACACTCGACGAC
                      ____________________________________________________________
consensus TTGCGCTCTNGCGATCCCACCACCTCCCTCTCTACAAATCAAGCGCTCACACTCGACGAC
 
. : . : . : . : . : . :
JMSF029A01+ GATGAGGAGAAATCCTGCACACAACACACACACCTCTTTCTCACACAAAAACATCATCAT
JMSF006O17+ TTTCTCACACAAAAACATCATCAT
                      ____________________________________________________________
consensus GATGAGGAGAAATCCTGCACACAACACACACACCTCTTTCTCACACAAAAACATCATCAT
 
. : . : . : . : . : . :
JMSF029A01+ CATCATCTTCATCATATACCACAAAAAACTCACCATTTTTCTTTCTAGAATTCTCAGGTC
JMSF006O17+ CATCATCTTCATCATATACCACAAAAAACTCACCATTTTTCTTTCTAGAATTCTCAGGTC
                      ____________________________________________________________
consensus CATCATCTTCATCATATACCACAAAAAACTCACCATTTTTCTTTCTAGAATTCTCAGGTC
 
. : . : . : . : . : . :
JMSF029A01+ AAAGGAACATACAAATGTTATGGAAGAAATTTAAGCGCACACACTAACCTTGGGCGATTC
JMSF006O17+ AAAGGAACATACAAATGTTATGGAAGAAATTTAAGCGCACACACTAACCTTGGGCGATTC
JMSF006N17+ TTGGGCGATTC
JMSF002M22+ CCTTGGGCGATTC
                      ____________________________________________________________
consensus AAAGGAACATACAAATGTTATGGAAGAAATTTAAGCGCACACACTAACCTTGGGCGATTC
 
. : . : . : . : . : . :
JMSF029A01+ AGATTTTCAAAACCCTAACTCGCTCTCTCTCGCTCGCTAACTCGCTCGACTCGCGCTCTT
JMSF006O17+ AGATTTTCAAAACCCTAACTCGCTCTCTCTCGCTCGCTAACTCGCTCGACTCGCGCTCTT
JMSF006N17+ AGATTTTCAAAACCCTAACTCGCTCTCTCTCGCTCGCTAACTCGCTCGACTCGCGCTNTT
JMSF002M22+ AGATTTTCAAAACCCTAACTCGCTCTCTCTCGCTCGCTAACTCGCTCGACTCGCGCTCTT
                      ____________________________________________________________
consensus AGATTTTCAAAACCCTAACTCGCTCTCTCTCGCTCGCTAACTCGCTCGACTCGCGCTCTT
 
. : . : . : . : . : . :
JMSF029A01+ CCTCTCGCCGCTCAGCGACTCCGTTTCAAACCCAATCTACTCATCCTGTACCCAACTCCC
JMSF006O17+ CCTCTCGCCGCTCAGCGACTCCGTTTCAAACCCAATCTACTCATCCTGTACCCAACTCCC
JMSF006N17+ CCTCTCGCCGCTCAGCGACTCCGTTTCAAACCCAATCTACTCATCCTGTACCCAACTCCC
JMSF002M22+ CCTCTCGCCGCTCAGCGACTCCGTTTCAAACCCAATCTACTCATCCTGTACCCAACTCCC
                      ____________________________________________________________
consensus CCTCTCGCCGCTCAGCGACTCCGTTTCAAACCCAATCTACTCATCCTGTACCCAACTCCC