Previous Contig 004444:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002M02Sequence366004444 (2)708002871 (5)gb:AP004300_18397988e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P047
JMSF051L08Sequence724004444 (2)gb:BT015414_16422422e-35Arabidopsis thaliana At3g06930 gene, complete cds.623002871 (5)gb:AP004300_18397986e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051L08+ CTGTCCTCACAT
                      ____________________________________________________________
consensus CTGTCCTCACAT
 
. : . : . : . : . : . :
JMSF051L08+ AGTCCTGCAACATATTCTGCTGATGCAAAAGCTGTCCATAATAATGGAAGTACATTTTGG
                      ____________________________________________________________
consensus AGTCCTGCAACATATTCTGCTGATGCAAAAGCTGTCCATAATAATGGAAGTACATTTTGG
 
. : . : . : . : . : . :
JMSF051L08+ CAGAAGATGCCTCAATTTTGTCATCAAATTTGCTGTTTGAAGTTTGCAATGCTCCATTTT
                      ____________________________________________________________
consensus CAGAAGATGCCTCAATTTTGTCATCAAATTTGCTGTTTGAAGTTTGCAATGCTCCATTTT
 
. : . : . : . : . : . :
JMSF051L08+ GCAAATGTGCTCCTTGTACAACCACTTGCTTTCTCCAATGTTCAAAGGCGCAATAGAAGG
                      ____________________________________________________________
consensus GCAAATGTGCTCCTTGTACAACCACTTGCTTTCTCCAATGTTCAAAGGCGCAATAGAAGG
 
. : . : . : . : . : . :
JMSF051L08+ CACTACTTTCCTTCTCCTTTGTAAATTGAATGGTAACTCCCCTTGAACAGGTCTCTTTGC
                      ____________________________________________________________
consensus CACTACTTTCCTTCTCCTTTGTAAATTGAATGGTAACTCCCCTTGAACAGGTCTCTTTGC
 
. : . : . : . : . : . :
JMSF051L08+ TGGTTTCAGAAGCTTCAGATACACAGAGCAATTGAACAGGGCTTAACCTAAACAGTTGAG
                      ____________________________________________________________
consensus TGGTTTCAGAAGCTTCAGATACACAGAGCAATTGAACAGGGCTTAACCTAAACAGTTGAG
 
. : . : . : . : . : . :
JMSF051L08+ AAGTTCGGAGATCAAACACAATCCCTTTATCCGGCTCAGATTCTCCCCCAAATCGAAGCT
JMSF002M02+ GAAGCT
                      ____________________________________________________________
consensus AAGTTCGGAGATCAAACACAATCCCTTTATCCGGCTCAGATTCTCCCCCAAATCGAAGCT
 
. : . : . : . : . : . :
JMSF051L08+ CGGCAACTCCGGAATCCAAGCCGAACCGAGCTAAAACCCGCTGCGAACCGGAAACGGAAG
JMSF002M02+ CGGCAACTCCGGAATCCAAGCCGAACCGAGCTAAAACCCGCTGCGAACCGGAAACGGAAG
                      ____________________________________________________________
consensus CGGCAACTCCGGAATCCAAGCCGAACCGAGCTAAAACCCGCTGCGAACCGGAAACGGAAG
 
. : . : . : . : . : . :
JMSF051L08+ CCGAATCTGCAGAAGAAGAAGAAGACAACGACGAAAGCTCCGAAATAGACGCAACAAAAA
JMSF002M02+ CCGAATCTGCAGAAGAAGAAGAAGACGACGACGAAAGCTCCGAAATAGACGCAACAAAAA
                      ____________________________________________________________
consensus CCGAATCTGCAGAAGAAGAAGAAGACGACGACGAAAGCTCCGAAATAGACGCAACAAAAA
 
. : . : . : . : . : . :
JMSF051L08+ ACTCCTGCCCTTCCTGCTTTTCTCCTATTTGAATCTCCATTTCTCGCTGACTTCAAGCTC
JMSF002M02+ ACTCCTGCCCTTCCTGCTTTTCTCCTATTTGAATCTCCATTTCTCGCTGACTTCAAGCTC
                      ____________________________________________________________
consensus ACTCCTGCCCTTCCTGCTTTTCTCCTATTTGAATCTCCATTTCTCGCTGACTTCAAGCTC
 
. : . : . : . : . : . :
JMSF051L08+ TCAGAGGCCTCTGATCAAAAGAATATTAATCGTATTCTGTTGCACAGAGTTACGGAGAGG
JMSF002M02+ TCAGAGGCCTCTGATCAAAAGAATATTAATCGTATTCTGTTGCACAGAGTTACGGAGAGG
                      ____________________________________________________________
consensus TCAGAGGCCTCTGATCAAAAGAATATTAATCGTATTCTGTTGCACAGAGTTACGGAGAGG
 
. : . : . : . : . : . :
JMSF051L08+ AATAGTTATACGTAAGCGTATGAATATGGTTAAGAATCCATGGGAGAAAAGGCGAGAATT
JMSF002M02+ AATAGTTATACGTAAGCGTATGAATATGGTTAAGAATCCATGGGAGAAAAGGCGAGAATT
                      ____________________________________________________________
consensus AATAGTTATACGTAAGCGTATGAATATGGTTAAGAATCCATGGGAGAAAAGGCGAGAATT
 
. : . : . : . : . : . :
JMSF051L08+ TAGGGTTTTGAGTGGGGGAGAGAGTCACAGTGACGAGCGGGGGAGAAGAGT
JMSF002M02+ TAGGGTTTTGAGTGGGGGAGAGAGTCACAGTGACGAGCGGGGGAGAAGAGTAAAGAGCCC
                      ____________________________________________________________
consensus TAGGGTTTTGAGTGGGGGAGAGAGTCACAGTGACGAGCGGGGGAGAAGAGTAAAGAGCCC