Previous Contig 004442:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001H14Sequence404004442 (2)gb:AY303171_15974122e-05Solanum bulbocastanum chromosome 8 clone 177O13, complete sequence.
JMSF002L22Sequence283004442 (2)709014006 (2)gb:AF266747_17819441e-17Solanum tuberosum RGC1 (RGC1) gene, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001H14+ TCGGCGAGTTCCCGTTTACGAAGCGGGTATTCGACGTCCAGAAA
                      ____________________________________________________________
consensus TCGGCGAGTTCCCGTTTACGAAGCGGGTATTCGACGTCCAGAAA
 
. : . : . : . : . : . :
JMSF001H14+ GCGTGTCCATTTCCTGTCGTAGTGGGATTTGGCGGCCACCACATATTGGTCGATGAGATC
                      ____________________________________________________________
consensus GCGTGTCCATTTCCTGTCGTAGTGGGATTTGGCGGCCACCACATATTGGTCGATGAGATC
 
. : . : . : . : . : . :
JMSF001H14+ CTCGGCCTTAGTGACCACCACCCGGATCTTGGTGATGAGGCGCTTGAGGATGTCGTTTTC
JMSF002L22+ CGGATCTTGGTGATGAGGCGCTTGAGGATGTCGTTTTC
                      ____________________________________________________________
consensus CTCGGCCTTAGTGACCACCACCCGGATCTTGGTGATGAGGCGCTTGAGGATGTCGTTTTC
 
. : . : . : . : . : . :
JMSF001H14+ GTAGCGGGACTTTCCGGCTTCTCTGAGGAAGGCCTTGAAGTCGTCCAGGTCATCTAGAAG
JMSF002L22+ GTAGCGGGACTTTCCGGCTTCTCTGAGGAAGGCCTTGAAGTCGTCCAGGTCATCTAGAAG
                      ____________________________________________________________
consensus GTAGCGGGACTTTCCGGCTTCTCTGAGGAAGGCCTTGAAGTCGTCCAGGTCATCTAGAAG
 
. : . : . : . : . : . :
JMSF001H14+ CTGCTCGACGTCGTCCTTGAGGCCGAAGATGAGCTTGATGTTCTCTTTTAGAAGCTGGGT
JMSF002L22+ CTGCTCGACGTCGTCCTTGAGGCCGAAGATGAGCTTGATGTTCTCTTTTAGAAGCTGGGT
                      ____________________________________________________________
consensus CTGCTCGACGTCGTCCTTGAGGCCGAAGATGAGCTTGATGTTCTCTTTTAGAAGCTGGGT
 
. : . : . : . : . : . :
JMSF001H14+ CAAATTCTCTATCAGCAAATTCACCACCACTTCTGCCAT
JMSF002L22+ CAAATTCTCTATCAGCAAATTCACCACCACTTCTGCCATTTCTGCCGCCCTCCCTCAATC
                      ____________________________________________________________
consensus CAAATTCTCTATCAGCAAATTCACCACCACTTCTGCCATTTCTGCCGCCCTCCCTCAATC
 
. : . : . : . : . : . :
JMSF002L22+ TATCAGCTCGTTTTCAGCTCAAAGATTCTTAATAGAAGCCATTGCCACCTTCAATGATTC
                      ____________________________________________________________
consensus TATCAGCTCGTTTTCAGCTCAAAGATTCTTAATAGAAGCCATTGCCACCTTCAATGATTC