Previous Contig 004441:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019B21Sequence572004441 (11)gb:AP003270_18268746e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050557004441 (11)gb:AP003270_18268745e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050
JMFF040B23Sequence527004441 (11)gb:AP003270_18268745e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050502004441 (11)gb:AP003270_18268744e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050
JMFN012A02Sequence611004441 (11)gb:AP003270_18268742e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050
JMFN028D16Sequence557004441 (11)gb:AP003270_18268745e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050
JMFS056F05Sequence485004441 (11)gb:AP003270_18268744e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050
JMSF002I19Sequence331004441 (11)gb:AP003270_18268743e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050462004441 (11)gb:AP003270_18268743e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050
JMSF002L19Sequence336004441 (11)gb:AP003270_18268749e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050540004441 (11)gb:AP003270_18268745e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN012A02+ TAACAAACAAACACGAATATTCGGTTCGT
                      ____________________________________________________________
consensus TAACAAACAAACACGAATATTCGGTTCGT
 
. : . : . : . : . : . :
JMFN028D16+ GAGAGAAGGCCTTCCTTCCATTCATACGCACGCAATAAG
JMFN012A02+ TAACAGCTGTACTTGAGAGTTGAGAGAAGGCCTTCCTTCCATTCATACTCACGCAATAAG
rJMFF019B21- TTCATACTCACGCAATAAG
JMFF019B21+ GAGAGAAGGCCTTCCTTCCATTCATACTCACGCAATAAG
                      ____________________________________________________________
consensus TAACAGCTGTACTTGAGAGTTGAGAGAAGGCCTTCCTTCCATTCATACTCACGCAATAAG
 
. : . : . : . : . : . :
JMFN028D16+ TTCAAATTTGTACTGTAATACTCGGGCATTTTAAGTTGTAATAAGGTGCACTTAACTGTT
JMFN012A02+ TTCAAATTTGTACTGTAATACTCGGGCATTTTAAGTTGTAATAAGGTGCACTTAACTGTT
rJMFF019B21- TTCAAATTTGTACTGTAATACTCGGGCATTTTAAGTTGTAATAAGGTGCACTTAACTGTT
JMFF040B23+ TTTGTACTGTAATACTCGGGCATTTTAAGTTGTAATAAGGTGCACTTAACTGTT
rJMFF040B23- AGTTGTAATAAGGTGCACTTAACTGTT
JMFS056F05+ GTACTGTAATACTCGGGCATTTTAAGTTGTAATAAGGTGCACTTAACTGTT
JMFF019B21+ TTCAAATTTGTACTGTAATACTCGGGCATTTTAAGTTGTAATAAGGTGCACTTAACTGTT
rJMSF002L19- AATTTGTACTGTAATACTCGGGCATTTTAAGTTGTAATAAGGTGCACTTAACTGTT
                      ____________________________________________________________
consensus TTCAAATTTGTACTGTAATACTCGGGCATTTTAAGTTGTAATAAGGTGCACTTAACTGTT
 
. : . : . : . : . : . :
JMFN028D16+ ACACAAATAATAGTCGTTCCTACAGACTCATAATATCCACA-GTAACAATTTTGAACAAG
JMFN012A02+ ACACAAATAATAGTCGTTCCTACAGACTCATAATATCCACA-GTAACAATTTTGAACAAG
rJMFF019B21- ACACAAATAATAGTCGTTCCTACAGACTCATAATATCCACA-GTAACAATTTTGAACAAG
JMFF040B23+ ACACAAATAATAGTCGTTCCTACAGACTCATAATATCCACA-GTAACAATTTTGAACAAG
rJMFF040B23- ACACAAATAATAGTCGTTCCTACAGACTCATAATATCCACA-GTAACAATTTTGAACAAG
JMFS056F05+ ACACAAATAATAGTCGTTCCTACAGACTCATAATATCCACA-GTAACAATTTTGAACAAG
rJMSF002I19- ATAGTCGTTCCTACAGACTCATAATATCCACAGGTAACAATTTTGAACAAG
JMFF019B21+ ACACAAATAATAGTCGTTCCTACAGACTCATAATATCCACA-GTAACAATTTTGAACAAG
rJMSF002L19- ACACAAATAATAGTCGTTCCTACAGACTCATAATATCCACA-GTAACAATTTTGAACAAG
                      ____________________________________________________________
consensus ACACAAATAATAGTCGTTCCTACAGACTCATAATATCCACA-GTAACAATTTTGAACAAG
 
. : . : . : . : . : . :
JMFN028D16+ GCAAAACCAAGCAAGCCTAAATTCCTTCTGAAATAGTACATCATTCGCACTACCACAGCA
JMFN012A02+ GCAAAACCAAGCAAGCCTAAATTCCTTCTGAAATAGTACATCATTCGCACTACCACAGCA
rJMFF019B21- GCAAAACCAAGCAAGCCTAAATTCCTTCTGAAATAGTACATCATTCGCACTACCACAGCA
JMFF040B23+ GCAAAACCAAGCAAGCCTAAATTCCTTCTGAAATAGTACATCATTCGCACTACCACAGCA
rJMFF040B23- GCAAAACCAAGCAAGCCTAAATTCCTTCTGAAATAGTACATCATTCGCACTACCACAGCA
JMFS056F05+ GCAAAACCAAGCAAGCCTAAATTCCTTCTGAAATAGTACATCATTCGCACTACCACAGCA
rJMSF002I19- GCAAAACCAAGCAAGCCTAAATTCCTTCTGAAATAGTACATCATTCGCACTACCACAGCA
JMFF019B21+ GCAAAACCAAGCAAGCCTAAATTCCTTCTGAAATAGTACATCATTCGCACTACCACAGCA
rJMSF002L19- GCAAAACCAAGCAAGCCTAAATTCCTTCTGAAATAGTACATCATTCGCACTACCACAGCA
                      ____________________________________________________________
consensus GCAAAACCAAGCAAGCCTAAATTCCTTCTGAAATAGTACATCATTCGCACTACCACAGCA
 
. : . : . : . : . : . :
JMFN028D16+ ATACCATTTCTTTGGTCAATCATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
JMFN012A02+ ATACCATTTCTTTGGTCAATCATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
rJMFF019B21- ATACCATTTCTTTGGTCAATCATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
JMFF040B23+ ATACCATTTCTTTGGTCAATCATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
rJMFF040B23- ATACCATTTCTTTGGTCAATCATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
JMFS056F05+ ATACCATTTCTTTGGTCAATCATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
rJMSF002I19- ATACCATTTCTTTGGTCAATCATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
JMSF002I19+ CATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
JMFF019B21+ ATACCATTTCTTTGGTCAATCATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
rJMSF002L19- ATACCATTTCTTTGGTCAATCATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
JMSF002L19+ CAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
                      ____________________________________________________________
consensus ATACCATTTCTTTGGTCAATCATGCAGTCCGCAGAGGAGGGGACACCAGTATTACACCAT
 
. : . : . : . : . : . :
JMFN028D16+ CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
JMFN012A02+ CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
rJMFF019B21- CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
JMFF040B23+ CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
rJMFF040B23- CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
JMFS056F05+ CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
rJMSF002I19- CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
JMSF002I19+ CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
JMFF019B21+ CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
rJMSF002L19- CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
JMSF002L19+ CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
                      ____________________________________________________________
consensus CTCCACGAACAAAAAGGAAAGGAATGGTCCGTTTTGTAGTCCTAACTATCTCCTCATATG
 
. : . : . : . : . : . :
JMFN028D16+ TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
JMFN012A02+ TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
rJMFF019B21- TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
JMFF040B23+ TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
rJMFF040B23- TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
JMFS056F05+ TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
rJMSF002I19- TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
JMSF002I19+ TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
JMFF019B21+ TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
rJMSF002L19- TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
JMSF002L19+ TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
                      ____________________________________________________________
consensus TTTCATCATCAATCTCAACAGTTGTCACAATTTCTTCAACATCACCAAGAATCATATTAA
 
. : . : . : . : . : . :
JMFN028D16+ GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
JMFN012A02+ GATGATGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
rJMFF019B21- GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
JMFF040B23+ GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
rJMFF040B23- GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
JMFS056F05+ GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
rJMSF002I19- GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
JMSF002I19+ GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
JMFF019B21+ GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
rJMSF002L19- GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
JMSF002L19+ GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
                      ____________________________________________________________
consensus GATGTTGATCATAAGCATGAAGTTTTCCGCGGAGTTCACGGTCGGAACGGAGCTTGACGT
 
. : . : . : . : . : . :
JMFN028D16+ AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
JMFN012A02+ AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
rJMFF019B21- AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
JMFF040B23+ AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
rJMFF040B23- AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
JMFS056F05+ AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
rJMSF002I19- AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
JMSF002I19+ AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
JMFF019B21+ AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
rJMSF002L19- AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
JMSF002L19+ AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
                      ____________________________________________________________
consensus AAATTCTCTCGTCGAGGCTGAGCCTGATAAGATCCAGCGGCTCCTTCACTGTGCTCTCTT
 
. : . : . : . : . : . :
JMFN028D16+ CTTCACTCCCCATTCTGTCTCTC
JMFN012A02+ CTTCACTCCCCATTCTGTCTCTCTCGGACTGCGCGCCTTTTCG
rJMFF019B21- CTTCACTCCCCATTCTGTCTCTCTCGGACTGCGCGCCTTTTCGATCCTTCAC
JMFF040B23+ CTTCACTCCCCATTCTGTCTCTCTCGGACTGCGCGCCTTTTCGATCCTTCAC
rJMFF040B23- CTTCACTCCCCATTCTGTCTCTCTCGGACTGCGCGCCTTTTCGATCCTTCAC
JMFS056F05+ CTTCACTCCCCATTC
rJMSF002I19- CTTCACTCCCCATTCTGTCTCTCTCGGACTGCGCGCCTTTTCGATCCTTC
JMSF002I19+ CTTCACTCCCCATTCTGTCTCTCTCGGACTGCGCGCCTTTTCGATCCTTC
JMFF019B21+ CTTCACTCCCCATTCTGTCTCTCTCGGACTGCGCGCCTTTTCGATCCTTCAC
rJMSF002L19- CTTCACTCCCCATTCTGTCTCTCTCGGACTGCGCGCCTTTTCGATCCTTCACACTTCCAG
JMSF002L19+ CTTCACTCCCCATTCTGTCTCTCTCGGACTGCGCGCCTTTTCGATCCTTCACACTTCCAG
                      ____________________________________________________________
consensus CTTCACTCCCCATTCTGTCTCTCTCGGACTGCGCGCCTTTTCGATCCTTCACACTTCCAG