Previous Contig 004434:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS078E11Sequence610004434 (2)
JMSF002K15Sequence341004434 (2)730013675 (3)pir|H86319|H863195e-35hypothetical protein F26I16.4 - Arabidopsis thaliana>gb:AE005172_890822 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS078E11+ CAAAAGCCAATTTGAAGACTTTTCCAGTCNCCACCCTCAAAGCC
                      ____________________________________________________________
consensus CAAAAGCCAATTTGAAGACTTTTCCAGTCNCCACCCTCAAAGCC
 
. : . : . : . : . : . :
JMFS078E11+ AGATGATCAGAACCCTTTAAAAATTGATGTCACAAATGAACCAACCATCTTCAACAACAT
                      ____________________________________________________________
consensus AGATGATCAGAACCCTTTAAAAATTGATGTCACAAATGAACCAACCATCTTCAACAACAT
 
. : . : . : . : . : . :
JMFS078E11+ AAATCCAGACAATCTTGGCCTCAGGTTTCAATCAAAGATTCAAAATTTCCCCAAAATACC
                      ____________________________________________________________
consensus AAATCCAGACAATCTTGGCCTCAGGTTTCAATCAAAGATTCAAAATTTCCCCAAAATACC
 
. : . : . : . : . : . :
JMFS078E11+ AGCACTTCCAGCTAACCAGAGTCCAAATCTAATTAGGTTATAACTTATAAGCATCTAAGA
                      ____________________________________________________________
consensus AGCACTTCCAGCTAACCAGAGTCCAAATCTAATTAGGTTATAACTTATAAGCATCTAAGA
 
. : . : . : . : . : . :
JMFS078E11+ CACTCCCTTCAGACAGAATTCAAGTCTTGGATACCTGTATCCCCTTAAGGCTTCAGCTTC
                      ____________________________________________________________
consensus CACTCCCTTCAGACAGAATTCAAGTCTTGGATACCTGTATCCCCTTAAGGCTTCAGCTTC
 
. : . : . : . : . : . :
JMFS078E11+ CAATGTGTTGAATGTCAATGCATGAAAATGCCAGAGAAATAGCATCTACCCAGGAAGATA
                      ____________________________________________________________
consensus CAATGTGTTGAATGTCAATGCATGAAAATGCCAGAGAAATAGCATCTACCCAGGAAGATA
 
. : . : . : . : . : . :
JMFS078E11+ AACTTAACAAAGGGGAGCGCCAATCAAATGTGGTTGAAATTACACTAGAATAGAAGCATT
JMSF002K15+ CCAATCAAATGTGGTTGAAATTACACTAGAATAGAAGCATT
                      ____________________________________________________________
consensus AACTTAACAAAGGGGAGCGCCAATCAAATGTGGTTGAAATTACACTAGAATAGAAGCATT
 
. : . : . : . : . : . :
JMFS078E11+ GTATTATAATCCTCCATAATTGTGAAGAGGGAAATGCAGGAGAGGGATGTGAGGGGGCAG
JMSF002K15+ GTATTATAATCCTCCATAATTGTGAAGAGGGAAATGCAGGAGAGGGATGTGAGGGGGCAG
                      ____________________________________________________________
consensus GTATTATAATCCTCCATAATTGTGAAGAGGGAAATGCAGGAGAGGGATGTGAGGGGGCAG
 
. : . : . : . : . : . :
JMFS078E11+ ATATTCCAGCAGACTTCCATGTGTAATGATGGTAGGGGTGGGTCTAAATATGTCTGCATG
JMSF002K15+ ATATTCCAGCAGACTTCCATGTGTAATGATGGTAGGGGTGGGTCTAAATATGTCTGCATG
                      ____________________________________________________________
consensus ATATTCCAGCAGACTTCCATGTGTAATGATGGTAGGGGTGGGTCTAAATATGTCTGCATG
 
. : . : . : . : . : . :
JMFS078E11+ CCCTCACCATGTGGAGCTGTCAGGATTGTGGCTAAGGTATTCAGAGAATTTGGGGTTTCT
JMSF002K15+ CCCTCACCATGTGGAGCTGTCAGGATTGTGGCTAAGGTATTCAGAGAATTTGGGGTTTCT
                      ____________________________________________________________
consensus CCCTCACCATGTGGAGCTGTCAGGATTGTGGCTAAGGTATTCAGAGAATTTGGGGTTTCT
 
. : . : . : . : . : . :
JMFS078E11+ GGGTCCGAGGGCTAACCTTTGACTCC
JMSF002K15+ GGGTCCGAGGGCTAACCTTTGACTCCACCTTTGAAGCAGAATAAGAGGATGATAGAGTTT
                      ____________________________________________________________
consensus GGGTCCGAGGGCTAACCTTTGACTCCACCTTTGAAGCAGAATAAGAGGATGATAGAGTTT
 
. : . : . : . : . : . :
JMSF002K15+ GGCATGGAATATGGATGATGTTTTTGGTCCAATTCTAAACCCAATCATGTCACCCCGTTC
                      ____________________________________________________________
consensus GGCATGGAATATGGATGATGTTTTTGGTCCAATTCTAAACCCAATCATGTCACCCCGTTC