Previous Contig 004429:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002J01Sequence381004429 (3)
JMSF005H13Sequence382004429 (3)103022140
JMSF043B12Sequence586004429 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043B12+ GATGCATGCGCCATTTCTGTTCTCTAATGGAGACAATCTTCGCTCTCCTGGAG
                      ____________________________________________________________
consensus GATGCATGCGCCATTTCTGTTCTCTAATGGAGACAATCTTCGCTCTCCTGGAG
 
. : . : . : . : . : . :
JMSF043B12+ TTGGGCTGGGAATGGATGAAATGGACTGTGTAACAGAAGTTGGAGATAATTCCAACACAG
                      ____________________________________________________________
consensus TTGGGCTGGGAATGGATGAAATGGACTGTGTAACAGAAGTTGGAGATAATTCCAACACAG
 
. : . : . : . : . : . :
JMSF043B12+ ATGGATCATCAGCAGACTGCAGTTGGTTCCGCCTTTGAGCTTGAACAGTTGAAGCTTTCT
                      ____________________________________________________________
consensus ATGGATCATCAGCAGACTGCAGTTGGTTCCGCCTTTGAGCTTGAACAGTTGAAGCTTTCT
 
. : . : . : . : . : . :
JMSF043B12+ GGTTAGAAATGCCAACCTCATCCTTGATTTCCTTCAGGAATTCGGTCGGGTGCAAGCTAT
JMSF005H13+ ATTCGGTCGGGTGCAAGCTAT
JMSF002J01+ ATTCGGTCGGGTGCAAGCTAT
                      ____________________________________________________________
consensus GGTTAGAAATGCCAACCTCATCCTTGATTTCCTTCAGGAATTCGGTCGGGTGCAAGCTAT
 
. : . : . : . : . : . :
JMSF043B12+ ACTCGATTGGAA---CAGAGAGCACGTGCGAGGAGGAGGAAGCAAGGGAATCCGGTCGGC
JMSF005H13+ ACTCGATTGGAACTTCAGAGAGCACGTGCGAGGAGGAGGAAGCAAGGGAATCCGGTCGGC
JMSF002J01+ ACTCGATTGGAACTTCAGAGAGCACGTGCGAGGAGGAGGAAGCAAGGGAATCCGGTCGGC
                      ____________________________________________________________
consensus ACTCGATTGGAACTTCAGAGAGCACGTGCGAGGAGGAGGAAGCAAGGGAATCCGGTCGGC
 
. : . : . : . : . : . :
JMSF043B12+ TAGCACTCTTATTCAACTGTATGGAAGGCGAGTCCACCGTATCTAGGGTTTCTTCGGAGT
JMSF005H13+ TAGCACTCTTATTCAACTGTATGGAAGGCGAGTCCACCGTATCTAGGGTTTCTTCGGAGT
JMSF002J01+ TAGCACTCTTATTCAACTGTATGGAAGGCGAGTCCACCGTATCTAGGGTTTCTTCGGAGT
                      ____________________________________________________________
consensus TAGCACTCTTATTCAACTGTATGGAAGGCGAGTCCACCGTATCTAGGGTTTCTTCGGAGT
 
. : . : . : . : . : . :
JMSF043B12+ CAGAACCTCCCACTTCAGCTTCTTCTGAAGTCTCAGTTCCAGTCGTCGCTCCACTAGGCT
JMSF005H13+ CAGAACCTCCCACTTCAGCTTCTTCTGAAGTCTCAGTTCCAGTCGTCGCTCCACTAGGCT
JMSF002J01+ CAGAACCTCCCACTTCAGCTTCTTCTGAAGTCTCAGTTCCAGTCGTCGCTCCACTAGGCT
                      ____________________________________________________________
consensus CAGAACCTCCCACTTCAGCTTCTTCTGAAGTCTCAGTTCCAGTCGTCGCTCCACTAGGCT
 
. : . : . : . : . : . :
JMSF043B12+ CATCACCACCGCCAACTCCGCCGCCGCTGTCGGCGCATGTATTTTGGAGCTGCAGAGATG
JMSF005H13+ CATCACCACCGCCAACTCCGCCGCCGCTGTCGGCGCATGTATTTTGGAGCTGCAGAGATG
JMSF002J01+ CATCACCACCGCCAACTCCGCCGCCGCTGTCGGCGCATGTATTTTGGAGCTGCAGAGATG
                      ____________________________________________________________
consensus CATCACCACCGCCAACTCCGCCGCCGCTGTCGGCGCATGTATTTTGGAGCTGCAGAGATG
 
. : . : . : . : . : . :
JMSF043B12+ GCTTAGACGCTTCTCCGGTGTCATCCATGGCGGATTCCCGAGCCCCAACAATGCACTTTC
JMSF005H13+ GCTTAGACGCTTCTCCGGTGTCATCCATGGCGGATTCCCGAGCCCCAACAATGCACTTTC
JMSF002J01+ GCTTAGACGCTTCTCCGGTGTCATCCATGGCGGATTCCCGAGCCCCAACAATGCACTTTC
                      ____________________________________________________________
consensus GCTTAGACGCTTCTCCGGTGTCATCCATGGCGGATTCCCGAGCCCCAACAATGCACTTTC
 
. : . : . : . : . : . :
JMSF043B12+ TGCGTGCAGAGAATAGAGAGAGAGAGAAGGTAAAGGTATTTCGAATAGTTCTGTT
JMSF005H13+ TGCGTGCAGAGAATAGAGAGAGAGAGAAGGTAAAGGTATTTCGAATAGTTCTGTT
JMSF002J01+ TGCGTGCAGAGAATAGAGAGAGAGAGAAGGTAAAGGTATTTCGAATAGTTCTGTTGGCTC
                      ____________________________________________________________
consensus TGCGTGCAGAGAATAGAGAGAGAGAGAAGGTAAAGGTATTTCGAATAGTTCTGTTGGCTC