Previous Contig 004426:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002I21Sequence296004426 (3)166012238 (3)
JMSF022C12Sequence572004426 (3)gb:AY120687_15795692e-16Arabidopsis thaliana AT3g10030/T22K18_15 mRNA, complete cds.>gb:AF375431_1792936690012238 (3)gb:AY120687_15795691e-25Arabidopsis thaliana AT3g10030/T22K18_15 mRNA, complete cds.>gb:AF375431_1792936
JMSF024M11Sequence655004426 (3)gb:AY120687_15795691e-12Arabidopsis thaliana AT3g10030/T22K18_15 mRNA, complete cds.>gb:AF375431_1792936743012238 (3)gb:AY120687_15795696e-47Arabidopsis thaliana AT3g10030/T22K18_15 mRNA, complete cds.>gb:AF375431_1792936

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022C12+ TCCCTCTCAAATTGCCTCTGTTGAGCTGCATAAACT
                      ____________________________________________________________
consensus TCCCTCTCAAATTGCCTCTGTTGAGCTGCATAAACT
 
. : . : . : . : . : . :
JMSF022C12+ TCTCCGTATACGCCTCCAGTAGGCACGCGATGGCCGTGTCACTCCATTCCTCCCGGTCCT
JMSF024M11+ CGTATACGCCTCCAGTAGGCACGCGATGGCCGTGTCACTCCATTCCTCCCGGTCCT
                      ____________________________________________________________
consensus TCTCCGTATACGCCTCCAGTAGGCACGCGATGGCCGTGTCACTCCATTCCTCCCGGTCCT
 
. : . : . : . : . : . :
JMSF022C12+ TCCTATACTCTCCACTTCCGCCGCCGCTGGAGGCGACAGATGAGTTGAGTTTTGACTTTT
JMSF024M11+ TCCTATACTCTCCACTTCCGCCGCCGCTGGAGGCGACAGATGAGTTGAGTTTTGACTTTT
                      ____________________________________________________________
consensus TCCTATACTCTCCACTTCCGCCGCCGCTGGAGGCGACAGATGAGTTGAGTTTTGACTTTT
 
. : . : . : . : . : . :
JMSF022C12+ TGTATGAATACGGAGTTCCGTTTTCACTGATATCATCTTGCTCCGCACGCTTACCGTTCC
JMSF024M11+ TGTATGAATACGGAGTTCCGTTTTCACTGATATCATCTTGCTCCGCACGCTTACCGTTCC
                      ____________________________________________________________
consensus TGTATGAATACGGAGTTCCGTTTTCACTGATATCATCTTGCTCCGCACGCTTACCGTTCC
 
. : . : . : . : . : . :
JMSF022C12+ CTGCACTAGCTCGAGATCTACTAGGATCGGGCTCGGTTTCGTAAGGATTGGAATCATTCT
JMSF024M11+ CTGCACTAGCTCGAGATCTACTAGGATCGGGCTCGGTTTCGTAAGGATTGGAATCATTCT
                      ____________________________________________________________
consensus CTGCACTAGCTCGAGATCTACTAGGATCGGGCTCGGTTTCGTAAGGATTGGAATCATTCT
 
. : . : . : . : . : . :
JMSF022C12+ CGTATGGATTCATCCCGACCACGTGATACGACGAGGAATTGCTATCTTTCGGATCCGGTT
JMSF024M11+ CGTATGGATTCATCCCGACCACGTGATACGACGAGGAATTGCTATCTTTCGGATCCGGTT
                      ____________________________________________________________
consensus CGTATGGATTCATCCCGACCACGTGATACGACGAGGAATTGCTATCTTTCGGATCCGGTT
 
. : . : . : . : . : . :
JMSF022C12+ GAGAGCAGAAAGCTCCTCCATCGCTGTAACCTTCGCCCTCAGGAGACACGACATCGTCCT
JMSF024M11+ GAGAGCAGAAAGCTCCTCCATCGCTGTAACCTTCGCCCTCAGGAGACACGACATCGTCCT
                      ____________________________________________________________
consensus GAGAGCAGAAAGCTCCTCCATCGCTGTAACCTTCGCCCTCAGGAGACACGACATCGTCCT
 
. : . : . : . : . : . :
JMSF022C12+ CGCCGGAAATGTCCTTGGGACTACTGCAGTGTATAGGATGCGCGTGGATTTGGGAGGCCT
JMSF024M11+ CGCCGGAAATGTCCTTGGGACTACTGCAGTGTATAGGATGCGCGTGGATTTGGGAGGCCT
JMSF002I21+ GGAAATGTCCTTGGGACTACTGCAGTGTATAGGATGCGCGTGGATTTGGGAGGCCT
                      ____________________________________________________________
consensus CGCCGGAAATGTCCTTGGGACTACTGCAGTGTATAGGATGCGCGTGGATTTGGGAGGCCT
 
. : . : . : . : . : . :
JMSF022C12+ TGAAGCGGTGAGATGAGAAGGCTTGGTGGTGGTGGTGATGGTGGAAATTGGGGTTAGCGT
JMSF024M11+ TGAAGCGGTGAGATGAGAAGGCTTGGTGGTGGTGGTGATGGTGGAAATTGGGGTTAGCGT
JMSF002I21+ TGAAGCGGTGAGATGAGAAGGCTTGGTGGTGGTGGTGATGGTGGAAATTGGGGTTAGCGT
                      ____________________________________________________________
consensus TGAAGCGGTGAGATGAGAAGGCTTGGTGGTGGTGGTGATGGTGGAAATTGGGGTTAGCGT
 
. : . : . : . : . : . :
JMSF022C12+ TGGGTGTAGTGGCGGTGGGAGTGGCGTTATCGTCACCGAGAAGAGGGAAATCGTC
JMSF024M11+ TGGGTGTAGTGGCGGTGGGAGTGGCGTTATCGTCACCGAGAAGAGGGAAATCGTCGTCAC
JMSF002I21+ TGGGTGTAGTGGCGGTGGGAGTGGCGTTATCGTCACCGAGAAGAGGGAAATCGTCGTCAC
                      ____________________________________________________________
consensus TGGGTGTAGTGGCGGTGGGAGTGGCGTTATCGTCACCGAGAAGAGGGAAATCGTCGTCAC
 
. : . : . : . : . : . :
JMSF024M11+ AGGATGCCATGAGAGGGCGGAGAAACGTTAGTGTTAGGGTTCTCAGAGACGGAACGTTTG
JMSF002I21+ AGGATGCCATGAGAGGGCGGAGAAACGTTAGTGTTAGGGTTCTCAGAGACGGAACGTTTG
                      ____________________________________________________________
consensus AGGATGCCATGAGAGGGCGGAGAAACGTTAGTGTTAGGGTTCTCAGAGACGGAACGTTTG
 
. : . : . : . : . : . :
JMSF024M11+ AGGGTCACCGTTACGGTAACACGATGCCGTGAATTTGGACGATGGAGGTGGAACC
JMSF002I21+ AGGGTCACCGTTACGGTAACACGATGCCGTGAATTTGGACGATGGAGGTGGAACCAACCC
                      ____________________________________________________________
consensus AGGGTCACCGTTACGGTAACACGATGCCGTGAATTTGGACGATGGAGGTGGAACCAACCC