Previous Contig 004420:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN040N21Sequence607004420 (2)gb:AY058069_15642082e-45Arabidopsis thaliana At2g46080/T3F17.27 mRNA, complete cds.
JMSF002H05Sequence374004420 (2)gb:AE016959_10234112e-07Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06796022023pir|E84898|E848984e-41hypothetical protein At2g46080 [imported] - Arabidopsis thaliana>gb:AC005397_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN040N21+ TAGGTAAGTTCAAACTCTCGGTGAGGCTATCCAGAATCCCGAAGCACTTCTCCA
                      ____________________________________________________________
consensus TAGGTAAGTTCAAACTCTCGGTGAGGCTATCCAGAATCCCGAAGCACTTCTCCA
 
. : . : . : . : . : . :
JMFN040N21+ GTCTTGGGTTGTTTGCATTAAGATGCTGCTTCCATCCATCCAACGACGAGCGTGCTCCAA
                      ____________________________________________________________
consensus GTCTTGGGTTGTTTGCATTAAGATGCTGCTTCCATCCATCCAACGACGAGCGTGCTCCAA
 
. : . : . : . : . : . :
JMFN040N21+ CAAACTTGTTCGCCCCGCCATCCACGTTGTGCAACGCACAGCGAATAAAAAGATTGCCCT
                      ____________________________________________________________
consensus CAAACTTGTTCGCCCCGCCATCCACGTTGTGCAACGCACAGCGAATAAAAAGATTGCCCT
 
. : . : . : . : . : . :
JMFN040N21+ GGTTGAGCCTCGAGATCTCGGAGCTGAGAGCGGTACAAACATCCAGCAACCTCACACTGT
                      ____________________________________________________________
consensus GGTTGAGCCTCGAGATCTCGGAGCTGAGAGCGGTACAAACATCCAGCAACCTCACACTGT
 
. : . : . : . : . : . :
JMFN040N21+ TGTCTAAGTACACATCAATCCACTTCTCATCCCAATCACTTACGGGAAGTTCAAGTGCAG
                      ____________________________________________________________
consensus TGTCTAAGTACACATCAATCCACTTCTCATCCCAATCACTTACGGGAAGTTCAAGTGCAG
 
. : . : . : . : . : . :
JMFN040N21+ AAAGAAGCGCTTTGATGTCGGAATGAATAACGGAAAGTGCAGCAATGGCACGTTGCATCC
                      ____________________________________________________________
consensus AAAGAAGCGCTTTGATGTCGGAATGAATAACGGAAAGTGCAGCAATGGCACGTTGCATCC
 
. : . : . : . : . : . :
JMFN040N21+ ACGATAAGCTGAGCACATCTTCCCCATCCACAGGCCCCAGACTCTTGAGTTTCTCTGCCA
                      ____________________________________________________________
consensus ACGATAAGCTGAGCACATCTTCCCCATCCACAGGCCCCAGACTCTTGAGTTTCTCTGCCA
 
. : . : . : . : . : . :
JMFN040N21+ CCGACTCCTCGAAAGTATTCAATAGAGAAAGAAGCCTTGAAGACAGGTGTGAGCCCTTAG
JMSF002H05+ CCTTAG
                      ____________________________________________________________
consensus CCGACTCCTCGAAAGTATTCAATAGAGAAAGAAGCCTTGAAGACAGGTGTGAGCCCTTAG
 
. : . : . : . : . : . :
JMFN040N21+ GAAATATCTTCCGGAAGGGGTTTCTTGGAGAACTCATTTTTAATATACAGAAAAGATTCA
JMSF002H05+ GAAATATCTTCCGGAAGGGGTTTCTTGGAGAACTCATTTTTAATATACAGAAAAGATTCA
                      ____________________________________________________________
consensus GAAATATCTTCCGGAAGGGGTTTCTTGGAGAACTCATTTTTAATATACAGAAAAGATTCA
 
. : . : . : . : . : . :
JMFN040N21+ AAAAAGCTTTAAATCTGAAGCCGATTCAGAGATTGAACGCCACAGATTTTAAGCAGATCA
JMSF002H05+ AAAAAGCTTTAAATCCGAAGCCGATTCAGAGATTGAACGCCACAGATTTTAAGCAGATCA
                      ____________________________________________________________
consensus AAAAAGCTTTAAATCTGAAGCCGATTCAGAGATTGAACGCCACAGATTTTAAGCAGATCA
 
. : . : . : . : . : . :
JMFN040N21+ ACT
JMSF002H05+ ACTGACCGAGTACCGAGTAGATAGAGAAAAGGAGGAATCTTCTTGGAATTTCACCCGCCA
                      ____________________________________________________________
consensus ACTGACCGAGTACCGAGTAGATAGAGAAAAGGAGGAATCTTCTTGGAATTTCACCCGCCA