Previous Contig 004416:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS109D07Sequence616004416 (4)gb:AY085333_15704053e-18Arabidopsis thaliana clone 1463 mRNA, complete sequence.>gb:AY091099_1574324 Ara
JMFS114C01Sequence621004416 (4)gb:AY085333_15704051e-59Arabidopsis thaliana clone 1463 mRNA, complete sequence.>gb:AY091099_1574324 Ara
JMSF002G10Sequence480004416 (4)gb:AF323104_17861442e-08Pisum sativum phosphatase-like protein Psc923 mRNA, complete cds.716004416 (4)gb:AY085333_15704056e-65Arabidopsis thaliana clone 1463 mRNA, complete sequence.>gb:AY091099_1574324 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002G10- AAATGGCAAA
                      ____________________________________________________________
consensus AAATGGCAAA
 
. : . : . : . : . : . :
rJMSF002G10- TAAAATGGCATGATGCCTTAAGCTTCCATCAATAGCAGCTCATACTTGAACTGAATTTAG
                      ____________________________________________________________
consensus TAAAATGGCATGATGCCTTAAGCTTCCATCAATAGCAGCTCATACTTGAACTGAATTTAG
 
. : . : . : . : . : . :
rJMSF002G10- TACATAATTTTCACTGATGGTATATAAATTGGAATGTTACCTAGCATGATTTGCTGAAGC
                      ____________________________________________________________
consensus TACATAATTTTCACTGATGGTATATAAATTGGAATGTTACCTAGCATGATTTGCTGAAGC
 
. : . : . : . : . : . :
rJMSF002G10- CTGAACGTAAATAAAGATTCGAATAAGCTAAACTCTCTGGATAACAACCGAATTGGCTAG
                      ____________________________________________________________
consensus CTGAACGTAAATAAAGATTCGAATAAGCTAAACTCTCTGGATAACAACCGAATTGGCTAG
 
. : . : . : . : . : . :
rJMSF002G10- CCCGGCTTGCTCTATTGTCTGCTCCAGATCGGTAAGTTGCTTCGGAGGAAACCCCACTGT
                      ____________________________________________________________
consensus CCCGGCTTGCTCTATTGTCTGCTCCAGATCGGTAAGTTGCTTCGGAGGAAACCCCACTGT
 
. : . : . : . : . : . :
rJMSF002G10- CTGCAGTTGGTAGGTCCTCGGACCACTGGGCCTTGATGCATCGATGAATCCTCGAATATC
                      ____________________________________________________________
consensus CTGCAGTTGGTAGGTCCTCGGACCACTGGGCCTTGATGCATCGATGAATCCTCGAATATC
 
. : . : . : . : . : . :
rJMSF002G10- TCTGATTGTGTGGTGGATGTTGAACCGGGAAACCATGCGTGTGCCATCAGCGAGCCTGAG
JMFS114C01+ GAG
                      ____________________________________________________________
consensus TCTGATTGTGTGGTGGATGTTGAACCGGGAAACCATGCGTGTGCCATCAGCGAGCCTGAG
 
. : . : . : . : . : . :
rJMSF002G10- CTGAATTGACGTGGAAGGTTGGGTTTCATCAACGACGAGACCCATGGCTGGGGCAGGAGC
JMFS114C01+ CTGAATTGACGTGGAAGGTTGGGTTTCATCAACGACGAGACCCATGGCTGGGGCAGGAGC
                      ____________________________________________________________
consensus CTGAATTGACGTGGAAGGTTGGGTTTCATCAACGACGAGACCCATGGCTGGGGCAGGAGC
 
. : . : . : . : . : . :
rJMSF002G10- AGAGGTTAAGGGAGCGGTTGCAACTGTTGTCTCTACTGGTGCATCGTCATTAGTAGTGCC
JMFS114C01+ AGAGGTTAAGGGAGCGGTTGCAACTGTTGTCTCTACTGGTGCATCGTCATTAGTAGTGCC
                      ____________________________________________________________
consensus AGAGGTTAAGGGAGCGGTTGCAACTGTTGTCTCTACTGGTGCATCGTCATTAGTAGTGCC
 
. : . : . : . : . : . :
rJMSF002G10- ACCTAAGGTTCTTCCTACACCCTGAAATGGTGTTTTCCGCTTCGCTGGTGCCGGGCAGTT
JMFS114C01+ ACCTAAGGTTCTTCCTACACCCTGAAATGGTGTTTTCCGCTTCGCTGGTGCCGGGCAGTT
                      ____________________________________________________________
consensus ACCTAAGGTTCTTCCTACACCCTGAAATGGTGTTTTCCGCTTCGCTGGTGCCGGGCAGTT
 
. : . : . : . : . : . :
rJMSF002G10- CTCCTCTCTCCTTGTGAGATTAACATGGACCGCTGTCCTCCTGTCTGGTGGCTGAAGTTC
JMFS114C01+ CTCCTCTCTCCTTGTGAGATTAACATGGACCGCTGTCCTCCTGTCTGGTGGCTGAAGTTC
                      ____________________________________________________________
consensus CTCCTCTCTCCTTGTGAGATTAACATGGACCGCTGTCCTCCTGTCTGGTGGCTGAAGTTC
 
. : . : . : . : . : . :
rJMSF002G10- CTTTGGGCACTCGGAATTCCTTATACTCTCCAAAAAGTGTGCATTTTCAGGATCATCCAT
JMFS114C01+ CTTTGGGCACTCGGAATTCCTTATACTCTCCAAAAAGTGTGCATTTTCAGGATCATCCAT
                      ____________________________________________________________
consensus CTTTGGGCACTCGGAATTCCTTATACTCTCCAAAAAGTGTGCATTTTCAGGATCATCCAT
 
. : . : . : . : . : . :
rJMSF002G10- CCTTCTGAGAGGTCCATCATCTACCGTGAACCCATTGCTCCAGAAA
JMFS114C01+ CCTTCTGAGAGGTCCATCATCTACCGTGAACCCATTGCTCCAGAAAGTGATATTATGGGT
                      ____________________________________________________________
consensus CCTTCTGAGAGGTCCATCATCTACCGTGAACCCATTGCTCCAGAAAGTGATATTATGGGT
 
. : . : . : . : . : . :
JMFS114C01+ AACAACTTCAGGTCGCTGAGGAGCAGAAGGAACAGTTTCACCAGTGAGTCGCCGTGCAGT
                      ____________________________________________________________
consensus AACAACTTCAGGTCGCTGAGGAGCAGAAGGAACAGTTTCACCAGTGAGTCGCCGTGCAGT
 
. : . : . : . : . : . :
JMFS114C01+ TCCAGTAAAGCTTCTTGAACTTGACGGAGGAAGATTCTCAACAGGTCCACCTACAGGTTG
JMFS109D07+ GAAGATTCTCAACAGGTCCACCTACAGGTTG
                      ____________________________________________________________
consensus TCCAGTAAAGCTTCTTGAACTTGACGGAGGAAGATTCTCAACAGGTCCACCTACAGGTTG
 
. : . : . : . : . : . :
JMFS114C01+ AGTCTGTCTGGCTTGGTTAAATATTGCATCCACATCATTCACTTTGGATGGATCTTGAAC
JMFS109D07+ AGTCTGTCTGGCTTGGTTAAATATTGCATCCACATCATTCACTTTGGATGGATCTTGAAC
                      ____________________________________________________________
consensus AGTCTGTCTGGCTTGGTTAAATATTGCATCCACATCATTCACTTTGGATGGATCTTGAAC
 
. : . : . : . : . : . :
JMFS114C01+ AAGCATTCCACT
JMFS109D07+ AAGCATTCCACTTTTTTCTCCACCAGTATAGTACTCCTGAGGCTCATCGGAGTCGCTCCC
                      ____________________________________________________________
consensus AAGCATTCCACTTTTTTCTCCACCAGTATAGTACTCCTGAGGCTCATCGGAGTCGCTCCC
 
. : . : . : . : . : . :
JMFS109D07+ GGATCCTGCAGCGGTTCGACGATTCAGATCAGCGAAGGTATGAATCCCGCCACTCCGCCG
JMSF002G10+ GGATCCTGCAGCGGTTCGACGATTCAGATCAGCGAAGGTATGAATCCCGCCANTCCGCCG
                      ____________________________________________________________
consensus GGATCCTGCAGCGGTTCGACGATTCAGATCAGCGAAGGTATGAATCCCGCCACTCCGCCG
 
. : . : . : . : . : . :
JMFS109D07+ GCCAGCACCACTACCGCCAGGGGCTGATGCGTTCCCGTGTTTAGAAGACCGGAGATTATA
JMSF002G10+ GCCAGCACCACTACCGCCAGGGGCTGATGCGTTCCCGTGTTTAGAAGACCGGAGATTATA
                      ____________________________________________________________
consensus GCCAGCACCACTACCGCCAGGGGCTGATGCGTTCCCGTGTTTAGAAGACCGGAGATTATA
 
. : . : . : . : . : . :
JMFS109D07+ CGCGCCGGAAGGCTGGGGCTGTTTGGAGCGACGGCGAGGGGAAGGGGATCGCGAGCGAGG
JMSF002G10+ CGCGCCGGAAGGCTGGGGCTGTTTGGAGCGACGGCGAGGGGAAGGGGATCGCGAGCGAGG
                      ____________________________________________________________
consensus CGCGCCGGAAGGCTGGGGCTGTTTGGAGCGACGGCGAGGGGAAGGGGATCGCGAGCGAGG
 
. : . : . : . : . : . :
JMFS109D07+ CGGAGAGGAAGACTCGGATTGGGAAGGGGAGTAGGGCAGGGAGTCAGCAGGGGAGTGTGC
JMSF002G10+ CGGAGAGGAAGACTCGGATTGGGAAGGGGAGTAGGGCAGGGAGTCAGCAGGGGAGTGTGC
                      ____________________________________________________________
consensus CGGAGAGGAAGACTCGGATTGGGAAGGGGAGTAGGGCAGGGAGTCAGCAGGGGAGTGTGC
 
. : . : . : . : . : . :
JMFS109D07+ GTTGGCCGTAGCGGCGGAGACGGCGGCGGGAGCGGGAACGTCGGCGGAGGGGTCGGCGGG
JMSF002G10+ GTTGGCCGTAGCGGCGGAGACGGCGGCGGGAGCGGGAACGTCGGCGGAGGGGTCGGCGGG
                      ____________________________________________________________
consensus GTTGGCCGTAGCGGCGGAGACGGCGGCGGGAGCGGGAACGTCGGCGGAGGGGTCGGCGGG
 
. : . : . : . : . : . :
JMFS109D07+ ATTGGTTTCGAAGTAGGTGGAGACGGCGGAGTCCAAGTCGAAGTTGTGGCTCTCGAGGTA
JMSF002G10+ ATTGGTTTCGAAGTAGGTGGAGACGGCGGAGTCCAAGTCGAAGTTGTGGCTCTCGAGGTA
                      ____________________________________________________________
consensus ATTGGTTTCGAAGTAGGTGGAGACGGCGGAGTCCAAGTCGAAGTTGTGGCTCTCGAGGTA
 
. : . : . : . : . : . :
JMFS109D07+ GAAGAGAGCTTCGGGATTGGTAGAAGAAGTGATTTCGCAGAATGTATTGATTAGGGTTTC
JMSF002G10+ GAAGAGAGCTTCGGGATTGGTAGAAGAAGTGATTTCGCAGAATGTATTGATTAGGGTTTC
                      ____________________________________________________________
consensus GAAGAGAGCTTCGGGATTGGTAGAAGAAGTGATTTCGCAGAATGTATTGATTAGGGTTTC
 
. : . : . : . : . : . :
JMFS109D07+ CCTTTCCGGGTTGAGATCGCTCTGGTTTTCCATGGCTTCTCTGCT
JMSF002G10+ CCTTTCCGGGTTGAGATCGCTCTGGTTTTCCATGGCTTCTCTGCTTTCTGAGTTCTCTCC
                      ____________________________________________________________
consensus CCTTTCCGGGTTGAGATCGCTCTGGTTTTCCATGGCTTCTCTGCTTTCTGAGTTCTCTCC