Previous Contig 004411:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002F24Sequence384004411 (2)752022020pir|E86443|E86443e-101probable G-protein alpha subunit [imported] - Arabidopsis thaliana>gb:AE005172_8
JMSF007F07Sequence321004411 (2)759011371 (2)pir|E86443|E864439e-22probable G-protein alpha subunit [imported] - Arabidopsis thaliana>gb:AE005172_8

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF002F24+ TAAAAGCACTGATNGGAACCAGTC
                      ____________________________________________________________
consensus TAAAAGCACTGATNGGAACCAGTC
 
. : . : . : . : . : . :
JMSF007F07+ TCTAATCAAGAAATTCCCAAGAT
JMSF002F24+ AAGTGAAAATCATTAGAAACCAGTTACCATCCCTATATCTAATCAAGAAATTCCCAAGAT
                      ____________________________________________________________
consensus AAGTGAAAATCATTAGAAACCAGTTACCATCCCTATATCTAATCAAGAAATTCCCAAGAT
 
. : . : . : . : . : . :
JMSF007F07+ GGAATTCAACTATTTATTTGGAATTCAACAAACGTTGATTTGCCCACCAAACTACTAAAA
JMSF002F24+ GGAATTCAACTATTTATTTGGAATTCAACAAACGTTGATTTGCCCACCAAACTACTAAAA
                      ____________________________________________________________
consensus GGAATTCAACTATTTATTTGGAATTCAACAAACGTTGATTTGCCCACCAAACTACTAAAA
 
. : . : . : . : . : . :
JMSF007F07+ AAGCCTTCAACTTTGAAACAGCCTGTAAATCTAGAAATTCCATAAAACTGAAAAGTACAA
JMSF002F24+ AAGCCTTCAACTTTGAAACAGCCTGTAAATCTAGAAATTCCATAAAACTGAAAAGTACAA
                      ____________________________________________________________
consensus AAGCCTTCAACTTTGAAACAGCCTGTAAATCTAGAAATTCCATAAAACTGAAAAGTACAA
 
. : . : . : . : . : . :
JMSF007F07+ GCCACGAGCTTTTCAACTAAACAGACCTAAAGACCCAAACACCTATCATTGAAAGATATA
JMSF002F24+ GCCACGAGCTTTTCAACTAAACAGACCTAAAGACCCAAACACCTATCATTGAAAGATATA
                      ____________________________________________________________
consensus GCCACGAGCTTTTCAACTAAACAGACCTAAAGACCCAAACACCTATCATTGAAAGATATA
 
. : . : . : . : . : . :
JMSF007F07+ AAAATAGAAACTTTTGATGAAAATTAAAGGCAAAGTAGTTGGTTGAAGGGGTGATCAACA
JMSF002F24+ AAAATAGAAACTTTTGATGAAAATTAAAGGCAAAGTAGTTGGTTGAAGGGGTGATCAACA
                      ____________________________________________________________
consensus AAAATAGAAACTTTTGATGAAAATTAAAGGCAAAGTAGTTGGTTGAAGGGGTGATCAACA
 
. : . : . : . : . : . :
JMSF007F07+ GGTCGGAAAGCTGAAATTTTCAGAGTCAAATCTAATATAATCAAACCCCAAGCC
JMSF002F24+ AGTCGGAAAGCTGAAATTTTCAGAGTCAAATCTAATATAATCAAACCCCAAGCCGCAACC
                      ____________________________________________________________
consensus GGTCGGAAAGCTGAAATTTTCAGAGTCAAATCTAATATAATCAAACCCCAAGCCGCAACC