Previous Contig 004410:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002F17Sequence389004410 (2)759011205 (2)pir|T52301|T523015e-10GYMNOS/PICKLE protein [imported] - Arabidopsis thaliana>gb:AF185577_1775125 Arab
JMSF004E17Sequence380004410 (2)360004609 (23)pir|H96608|H966085e-35hypothetical protein F25P12.86 [imported] - Arabidopsis thaliana>gb:AE005173_893

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF002F17+ ATCAAGAAGCTCGAAGAACGAAGAAGGTA
                      ____________________________________________________________
consensus ATCAAGAAGCTCGAAGAACGAAGAAGGTA
 
. : . : . : . : . : . :
JMSF002F17+ CTATTGCCTTGCCGCTACACCGCCGCCGCTTGTTGTAGTTAAGACNTGTNTGAAGAGCNG
                      ____________________________________________________________
consensus CTATTGCCTTGCCGCTACACCGCCGCCGCTTGTTGTAGTTAAGACNTGTNTGAAGAGCNG
 
. : . : . : . : . : . :
JMSF004E17+ CCTAAAATGAGTAG
JMSF002F17+ AATTGAAGATGGAGGCCGGAAGAGTAGATCGTGATATTTATTAACGCCTAAAATGAGTAG
                      ____________________________________________________________
consensus AATTGAAGATGGAGGCCGGAAGAGTAGATCGTGATATTTATTAACGCCTAAAATGAGTAG
 
. : . : . : . : . : . :
JMSF004E17+ ATTTTCCCNGTCAACGGAGATNTGTTAAGAGCTTCCCTATTTGAGCTGAAACCNTTGGAT
JMSF002F17+ ATTTTCCCNGTCAACGGAGATNTGTTAAGAGCTTCCCTATTTGAGCTGAAACCNTTGGAT
                      ____________________________________________________________
consensus ATTTTCCCNGTCAACGGAGATNTGTTAAGAGCTTCCCTATTTGAGCTGAAACCNTTGGAT
 
. : . : . : . : . : . :
JMSF004E17+ ATAGGCCGGCCGGCNTGAGCNGGTTGAAGAGAGGTTTAATAGATCTTGGACTACTGAACG
JMSF002F17+ ATAGGCCGGCCGGCNTGAGCNGGTTGAAGAGAGGTTTAATAGATNTTGGACTACTGAACG
                      ____________________________________________________________
consensus ATAGGCCGGCCGGCNTGAGCNGGTTGAAGAGAGGTTTAATAGATCTTGGACTACTGAACG
 
. : . : . : . : . : . :
JMSF004E17+ CATCCAGATCCGGGNTGCGGTNTTCATTTGAGAGAGGGCCGTCAGTTCGCTCNTGNTTCT
JMSF002F17+ CATCCAGATCCGGGNTGCGGTNTTCATTTGAGAGAGGGCCGTCAGTTCGCTCNTGCTTCT
                      ____________________________________________________________
consensus CATCCAGATCCGGGNTGCGGTNTTCATTTGAGAGAGGGCCGTCAGTTCGCTCNTGCTTCT
 
. : . : . : . : . : . :
JMSF004E17+ TTATTTTCATTTTTTTTTTTGTGTTGAAATCAGTTTGGTTGATGCCGCCGATGCATC
JMSF002F17+ TTATTTTCATTTTTTTTTTTGTGTTGAAATCAGTTTGGTTGATGCCGCCGATGCATCATG
                      ____________________________________________________________
consensus TTATTTTCATTTTTTTTTTTGTGTTGAAATCAGTTTGGTTGATGCCGCCGATGCATCATG