Previous Contig 004407:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002F04Sequence385004407 (3)260012242 (3)gb:AF309490_17849930.002Coccidioides immitis spherule outer wall glycoprotein (SOWgp66) mRNA, complete c
JMSF022D22Sequence658004407 (3)332012242 (3)pir|T32711|T327110.038hypothetical protein T22D1.2 - Caenorhabditis elegans>gb:AF039052_1235428 Caenor
JMSF047M12Sequence663004407 (3)323012242 (3)pir|T32711|T327110.007hypothetical protein T22D1.2 - Caenorhabditis elegans>gb:AF039052_1235428 Caenor

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022D22+ GCCTTCAACCCC
JMSF047M12+ TTCAACCCC
                      ____________________________________________________________
consensus GCCTTCAACCCC
 
. : . : . : . : . : . :
JMSF022D22+ CTTGAATACAAGAAATCCCACTAACCCTACAGCCACTATCAGATGCAGAAGAAACAGAAA
JMSF047M12+ CTTGAATACAAGAAATCCCACTAACCCTACAGCCACTATCAGATGCAGAAGAAACAGAAA
                      ____________________________________________________________
consensus CTTGAATACAAGAAATCCCACTAACCCTACAGCCACTATCAGATGCAGAAGAAACAGAAA
 
. : . : . : . : . : . :
JMSF022D22+ CAGGGAAAACTTGTTTGTGTATGCTCTTGAATTCAGTGTTATCACTGCACGTTGTTGGGG
JMSF047M12+ CAGGGAAAACTTGTTTGTGTATGCTCTTGAATTCAGTGTTATCACTGCACGTTGTTGGGG
                      ____________________________________________________________
consensus CAGGGAAAACTTGTTTGTGTATGCTCTTGAATTCAGTGTTATCACTGCACGTTGTTGGGG
 
. : . : . : . : . : . :
JMSF022D22+ AGTAACCGTGACGGTAGGGGTGGAGCGCGGCTGGGAAGAAGGGGGAGGAGAAGGAGAAGG
JMSF047M12+ AGTAACCGTGACGGTAGGGGTGGAGCGCGGCTGGGAAGAAGGGGGAGGAGAAGGAGAAGG
                      ____________________________________________________________
consensus AGTAACCGTGACGGTAGGGGTGGAGCGCGGCTGGGAAGAAGGGGGAGGAGAAGGAGAAGG
 
. : . : . : . : . : . :
JMSF022D22+ TGAAATGTGAGGCGGCGGAGAGGGGGAAGGTTGTGGCGGCGGAGAAGGAGAAGGGATAGG
JMSF047M12+ TGAAATGTGAGGCGGCGGAGAGGGGGAAGGTTGTGGCGGCGGAGAAGGAGAAGGGATAGG
                      ____________________________________________________________
consensus TGAAATGTGAGGCGGCGGAGAGGGGGAAGGTTGTGGCGGCGGAGAAGGAGAAGGGATAGG
 
. : . : . : . : . : . :
JMSF022D22+ AGGCTGGGAAGGAGAAGGGCGAGGCGGTTGAGGAGGAGGAGGATGAGAACGGCGAGGCGG
JMSF047M12+ AGGCTGGGAAGGAGAAGGGCGAGGCGGTTGAGGAGGAGGAGGATGAGAACGGAGAGGCGG
JMSF002F04+ GAGGAGGATGAGAACGGCGAGGCGG
                      ____________________________________________________________
consensus AGGCTGGGAAGGAGAAGGGCGAGGCGGTTGAGGAGGAGGAGGATGAGAACGGCGAGGCGG
 
. : . : . : . : . : . :
JMSF022D22+ CTGAGGAGGAGAAGGTGAGGCAACTCTGATGGCACTTTCCATTACAAGCCGAAGAGGGTT
JMSF047M12+ CTGAGGAGGAGAAGGTGAGGCAACTCTGATGGCACTTTCCATTACAAGCCGAAGAGGGTT
JMSF002F04+ CTGAGGAGGAGAAGGTGAGGCAACTCTGATGGCACTTTCCATTACAAGCCGAAGAGGGTT
                      ____________________________________________________________
consensus CTGAGGAGGAGAAGGTGAGGCAACTCTGATGGCACTTTCCATTACAAGCCGAAGAGGGTT
 
. : . : . : . : . : . :
JMSF022D22+ TGTAGCACTCAGCCTTTGCATTCTCCCCATGTGAAAACCATGACCGCCACCACCACCCGC
JMSF047M12+ TGTAGCACTCAGCCTTTGCATTCTCCCCATGTGAAAACCATGACCGCCACCACCACCCGC
JMSF002F04+ TGTAGCACTCAGCCTTTGCATTCTCCCCATGTGAAAACCATGACCGCCACCACCACCCGC
                      ____________________________________________________________
consensus TGTAGCACTCAGCCTTTGCATTCTCCCCATGTGAAAACCATGACCGCCACCACCACCCGC
 
. : . : . : . : . : . :
JMSF022D22+ CGGCGCCGGCGGCGCCGGCGGGTAGTTGTAACTCCCTCCCGCCTGAAAACCCATCTCACC
JMSF047M12+ CGGCGCCGGCGGCGCCGGCGGGTAGTTGTAACTCCCTCCCGCCTGAAAACCCATCTCACC
JMSF002F04+ CGGCGCCGGCGGCGCCGGCGGGTAGTTGTAACTCCCTCCCGCCTGAAAACCCATCTCACC
                      ____________________________________________________________
consensus CGGCGCCGGCGGCGCCGGCGGGTAGTTGTAACTCCCTCCCGCCTGAAAACCCATCTCACC
 
. : . : . : . : . : . :
JMSF022D22+ TCTCTCCACATCTCTCTGCCTCTCCTCCGCTTCTCTTTCATTATTCTCTCTCTCAACCAC
JMSF047M12+ TCTCTCCACATCTCTCTGCCTCTCCTCCGCTTCTCTTTCATTATTCTCTCTCTCAACCAC
JMSF002F04+ TCTCTCCACATCTCTCTGCCTCTCCTCCGCTTCTCTTTCATTATTCTCTCTCTCAACCAC
                      ____________________________________________________________
consensus TCTCTCCACATCTCTCTGCCTCTCCTCCGCTTCTCTTTCATTATTCTCTCTCTCAACCAC
 
. : . : . : . : . : . :
JMSF022D22+ AGGTTCCGAGGCGCCCATTGACGGTGGATCGAGGCGGCGCGTGGAGGTGATGAGGAGGAG
JMSF047M12+ AGGTTCCGAGGCGCCCATTGACGGTGGATCGAGGCGGCGCGTGGAGGTGATGAGGAGGAG
JMSF002F04+ AGGTTCCGAGGCGCCCATTGACGGTGGATCGAGGCGGCGCGTGGAGGTGATGAGGAGGAG
                      ____________________________________________________________
consensus AGGTTCCGAGGCGCCCATTGACGGTGGATCGAGGCGGCGCGTGGAGGTGATGAGGAGGAG
 
. : . : . : . : . : . :
JMSF022D22+ AGTTAAGATTTTGTTGGTATGTGGTGGCTGATGTTCAAACGTTGCC
JMSF047M12+ AGTTAAGATTTTGTTGGTATGTGGTGGCTGATGTTCAAACGTTGCCAGCAGGC
JMSF002F04+ AGTTAAGATTTTGTTGGTATGTGGTGGCTGATGTTCAAACGTTGCCAGCAGGCATCACCC
                      ____________________________________________________________
consensus AGTTAAGATTTTGTTGGTATGTGGTGGCTGATGTTCAAACGTTGCCAGCAGGCATCACCC