Previous Contig 004401:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024A06Sequence501004401 (4)gb:AF321984_17860541e-29Lycopersicon esculentum lethal leaf spot 1-like protein mRNA, complete cds.750009334 (4)gb:AF321984_17860542e-99Lycopersicon esculentum lethal leaf spot 1-like protein mRNA, complete cds.
JMFS044C09Sequence622004401 (4)gb:AF321984_17860546e-72Lycopersicon esculentum lethal leaf spot 1-like protein mRNA, complete cds.
JMSF002D20Sequence337004401 (4)gb:VCA311550_17269950.001Volvox carteri f. nagariensis mRNA for metalloproteinase (VMP4 protein).727009334 (4)gb:AF321984_17860541e-98Lycopersicon esculentum lethal leaf spot 1-like protein mRNA, complete cds.
JMSF037N16Sequence579004401 (4)gb:AF321984_17860541e-37Lycopersicon esculentum lethal leaf spot 1-like protein mRNA, complete cds.683009334 (4)gb:AF321984_17860543e-91Lycopersicon esculentum lethal leaf spot 1-like protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS044C09+ TCAGGCCAGACAAAGAGAAGTCCCTGAGACACCATAGCCGG
                      ____________________________________________________________
consensus TCAGGCCAGACAAAGAGAAGTCCCTGAGACACCATAGCCGG
 
. : . : . : . : . : . :
JMFS044C09+ AAGCTTGGTGGCGCATGCCCTGGGCGACTTAACGGCACGCGCCTCCGGTCCCTCCGAGGC
                      ____________________________________________________________
consensus AAGCTTGGTGGCGCATGCCCTGGGCGACTTAACGGCACGCGCCTCCGGTCCCTCCGAGGC
 
. : . : . : . : . : . :
JMFS044C09+ AGCCTGCGGGATCCTCGTACAAGACCCACACCCATCAAACGACCACCCATGGTACGAGCA
                      ____________________________________________________________
consensus AGCCTGCGGGATCCTCGTACAAGACCCACACCCATCAAACGACCACCCATGGTACGAGCA
 
. : . : . : . : . : . :
JMFS044C09+ CTGCAAATGCCCGTTTTCGTCTAATCTCCCTTCAGATAAAGGAGCGAGGCGGTGGGGGCA
JMFF024A06+ CAGATAAAGGAGCGAGGCGGTGGGGGCA
JMSF037N16+ CAGATAAAGGAGCGAGGCGGTGGGGGCA
                      ____________________________________________________________
consensus CTGCAAATGCCCGTTTTCGTCTAATCTCCCTTCAGATAAAGGAGCGAGGCGGTGGGGGCA
 
. : . : . : . : . : . :
JMFS044C09+ TTTGTCGTCCATGGCGA-CCCACTGGGAGGTGGATTTATCGAACCAGAGAACGATCTCGC
JMFF024A06+ TTTGTCGTCCATGGCGACCCCACTGGGAGGTGGATTTATCGAACCAGAGAACGATCTCGC
JMSF037N16+ TTTGTCGTCCATGGCGA-CCCACTGGGAGGTGGATTTATCGAACCAGAGAACGATCTCGC
                      ____________________________________________________________
consensus TTTGTCGTCCATGGCGA-CCCACTGGGAGGTGGATTTATCGAACCAGAGAACGATCTCGC
 
. : . : . : . : . : . :
JMFS044C09+ GGTTAAGGAGCTGAAAAGGGGTGGGCAGAGCCGGGTCGAGATCTTCCACTAGGGAAACCG
JMFF024A06+ GGTTAAGGAGCTGAAAAGGGGTGGGCAGAGCCGGGTCGAGATCTTCCACTAGGGAAACCG
JMSF037N16+ GGTTAAGGAGCTGAAAAGGGGTGGGCAGAGCCGGGTCGAGATCTTCCACTAGGGAAACCG
                      ____________________________________________________________
consensus GGTTAAGGAGCTGAAAAGGGGTGGGCAGAGCCGGGTCGAGATCTTCCACTAGGGAAACCG
 
. : . : . : . : . : . :
JMFS044C09+ GGTACCAATGGTCCCGCCAATTGAACTTAGACGATGAACCATCTTCGCCCATCTGGCTCA
JMFF024A06+ GGTACCAATGGTCCCGCCAATTGNACTTAGACGATGAACCATCTTCGCCCATCTGGCTCA
JMSF037N16+ GGTACCAATGGTCCCGCCAATTGAACTTAGACGATGAACCATCTTCGCCCATCTGGCTCA
                      ____________________________________________________________
consensus GGTACCAATGGTCCCGCCAATTGAACTTAGACGATGAACCATCTTCGCCCATCTGGCTCA
 
. : . : . : . : . : . :
JMFS044C09+ CAAGTTCATCATCCCTTTCATTCGATCCCAAAATTGGGTCCTCGGATGCCTGAGGCGGGG
JMFF024A06+ CAAGTTCATCATCCCTTTCATTCGATCCCAAAATTGGGTCCTCGGATGCCTGAGGCGGGG
JMSF037N16+ CAAGTTCATCATCCCTTTCATTCGATCCCAAAATTGGGTCCTCGGATGCCTGAGGCGGGG
JMSF002D20+ GATCCCAAAATTGGGTCCTCGGATGCCTGAGGCGGGG
                      ____________________________________________________________
consensus CAAGTTCATCATCCCTTTCATTCGATCCCAAAATTGGGTCCTCGGATGCCTGAGGCGGGG
 
. : . : . : . : . : . :
JMFS044C09+ TGGTGGGCGGCGCCGCCACGCGAAGAGGGGTCACAGCGCTCCTCCTCCTCCTTCTCCCTC
JMFF024A06+ TGGTGGGCGGCGCCGCCACGCGAAGAGGGGTCACAGCGCTCCTCCTCCTCCTTCTCCCTC
JMSF037N16+ TGGTGGGCGGCGCCGCCACGCGAAGAGGGGTCACAGCGCTCCTCCTCCTCCTTCTCCCTC
JMSF002D20+ TGGTGGGCGGCGCCGCCACGCGAAGAGGGGTCACAGCGCTCCTCCTCCTCCTTCTCCCTC
                      ____________________________________________________________
consensus TGGTGGGCGGCGCCGCCACGCGAAGAGGGGTCACAGCGCTCCTCCTCCTCCTTCTCCCTC
 
. : . : . : . : . : . :
JMFS044C09+ GGAAACACAACGCGTTACTGGGGTGCGGAGAGAGCGAGGAGCGAAGGGGAGAGAGAACTG
JMFF024A06+ GGAAACACAACGCGTTACTGGGGTGCGGAGAGAGCGAGGAGCGAAGGGGAGAGAGAACTG
JMSF037N16+ GGAAACACAACGCGTTACTGGGGTGCGGAGAGAGCGAGGAGCGAAGGGGAGAGAGAACTG
JMSF002D20+ GGAAACACAACGCGTTACTGGGGTGCGGAGAGAGCGAGGAGCGAAGGGGAGAGAGAACTG
                      ____________________________________________________________
consensus GGAAACACAACGCGTTACTGGGGTGCGGAGAGAGCGAGGAGCGAAGGGGAGAGAGAACTG
 
. : . : . : . : . : . :
JMFS044C09+ AGAGAGTGTGGAGAGTGGGGGAGAGCGAAGAAGCCATGGGAA
JMFF024A06+ AGAGAGTGTGGAGAGTGGGGGAGAGCGAAGAAGCCATGGGAATGGGAATACAGATTGGAA
JMSF037N16+ AGAGAGTGTGGAGAGTGGGGGAGAGCGAAGAAGCCATGGGAATGGGAATACAGATTGGAA
JMSF002D20+ AGAGAGTGTGGAGAGTGGGGGAGAGCGAAGAAGCCATGGGAATGGGAATACAGATTGGAA
                      ____________________________________________________________
consensus AGAGAGTGTGGAGAGTGGGGGAGAGCGAAGAAGCCATGGGAATGGGAATACAGATTGGAA
 
. : . : . : . : . : . :
JMFF024A06+ GGAAAGCGGTGAGAGGAGGGATTATTATTATTATTATGCAGAATTC
JMSF037N16+ GGAAAGCGGTGAGAGGAGGGATTATTATTATTATTATGCAGAATTCAATTCATTCGGCGA
JMSF002D20+ GGAAAGCGGTGAGAGGAGGGATTATTATTATTATTATGCAGAATTCAATTCATTCGGCGA
                      ____________________________________________________________
consensus GGAAAGCGGTGAGAGGAGGGATTATTATTATTATTATGCAGAATTCAATTCATTCGGCGA
 
. : . : . : . : . : . :
JMSF037N16+ AGCGGTGATGGAGTGTGGAATGGAAGTGAAAGAAGGCTTTGCGTGCAAGGTAGAAAGTTC
JMSF002D20+ AGCGGTGATGGAGTGTGGAATGGAAGTGAAAGAAGGCTTTGCGTGCAAGGTAGAAAGTTC
                      ____________________________________________________________
consensus AGCGGTGATGGAGTGTGGAATGGAAGTGAAAGAAGGCTTTGCGTGCAAGGTAGAAAGTTC