Previous Contig 004399:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023A03Sequence487004399 (3)pir|G85440|G854407e-26hypothetical protein AT4g37300 [imported] - Arabidopsis thaliana>gb:ATAP21_15439802004399 (3)pir|G85440|G854402e-35hypothetical protein AT4g37300 [imported] - Arabidopsis thaliana>gb:ATAP21_15439
JMSF002D12Sequence331004399 (3)pir|G85440|G854404e-11hypothetical protein AT4g37300 [imported] - Arabidopsis thaliana>gb:ATAP21_15439742022013pir|G85440|G854401e-15hypothetical protein AT4g37300 [imported] - Arabidopsis thaliana>gb:ATAP21_15439

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023A03- TTGCAGAGAATCTAGACGACATGTTTAGATATTCAAACACAATTACA
                      ____________________________________________________________
consensus TTGCAGAGAATCTAGACGACATGTTTAGATATTCAAACACAATTACA
 
. : . : . : . : . : . :
rJMFF023A03- ACAACAGAACCTTGACGACATTATAAGTACCACCATTTGGTGGCACAGATCAAGAAATGA
                      ____________________________________________________________
consensus ACAACAGAACCTTGACGACATTATAAGTACCACCATTTGGTGGCACAGATCAAGAAATGA
 
. : . : . : . : . : . :
rJMFF023A03- GAATGTTGGGATTCCAACTCATATCTAATTACTAAATATTAAAGCAAATCTCTCACTTTT
                      ____________________________________________________________
consensus GAATGTTGGGATTCCAACTCATATCTAATTACTAAATATTAAAGCAAATCTCTCACTTTT
 
. : . : . : . : . : . :
rJMFF023A03- TATTCACTTCTTTTTTTATTCTCTGCTTCTAGATGACTCGATCTGATTCACCCTAGAGTA
                      ____________________________________________________________
consensus TATTCACTTCTTTTTTTATTCTCTGCTTCTAGATGACTCGATCTGATTCACCCTAGAGTA
 
. : . : . : . : . : . :
rJMFF023A03- CACTCGTAGTTGGCCGGTGGTCTAGTCACCCTCGCTCCGATTTGGCTTGGAAGAAGAAAA
                      ____________________________________________________________
consensus CACTCGTAGTTGGCCGGTGGTCTAGTCACCCTCGCTCCGATTTGGCTTGGAAGAAGAAAA
 
. : . : . : . : . : . :
rJMFF023A03- CTGGACCTGATCTTCAACGCTGGGAATCCAATCATTAGTTCCAGGATTAGTCTTGAACAC
                      ____________________________________________________________
consensus CTGGACCTGATCTTCAACGCTGGGAATCCAATCATTAGTTCCAGGATTAGTCTTGAACAC
 
. : . : . : . : . : . :
rJMFF023A03- TGCAGCTTTGAATCCATTGCTGCAGTTTTCTTGGCCTTGGTTCAACTGAAACTCGTATCC
JMFF023A03+ TGGTTCAACTGAAACTCGTATCC
                      ____________________________________________________________
consensus TGCAGCTTTGAATCCATTGCTGCAGTTTTCTTGGCCTTGGTTCAACTGAAACTCGTATCC
 
. : . : . : . : . : . :
rJMFF023A03- GTTTTCACCACCCACCTTTATGAACCCAGTTCCCGTCGTATGATGCTGCTTGTCAATAGA
JMFF023A03+ GTTTTCACCACCCACCTTTATGAACCCAGTTCCCGTCGTATGATGCTGCTTGTCAATAGA
                      ____________________________________________________________
consensus GTTTTCACCACCCACCTTTATGAACCCAGTTCCCGTCGTATGATGCTGCTTGTCAATAGA
 
. : . : . : . : . : . :
rJMFF023A03- AACCAGCTCATCGTAATAGTGAGTCTCTACGAATTCCTCTTGCTCCACTTTATCAGTTTC
JMFF023A03+ AACCAGCTCATCGTAATAGTGAGTCTCTACGAATTCCTCTTGCTCCACTTTATCAGTTTC
                      ____________________________________________________________
consensus AACCAGCTCATCGTAATAGTGAGTCTCTACGAATTCCTCTTGCTCCACTTTATCAGTTTC
 
. : . : . : . : . : . :
rJMFF023A03- TAAAAATACAGCTTGCGATCGGAGGGATTGGAGCTTATCAAGTTCAGGAATAGGGATGTC
JMFF023A03+ TAAAAATACAGCTTGCGATCGGAGGGATTGGAGCTTATCAAGTTCAGGAATAGGGATGTC
JMSF002D12+ GGAGCTTATCAAGTTCAGGAATAGGGATGTC
                      ____________________________________________________________
consensus TAAAAATACAGCTTGCGATCGGAGGGATTGGAGCTTATCAAGTTCAGGAATAGGGATGTC
 
. : . : . : . : . : . :
rJMFF023A03- TCCGGCGGGCATTGGGAGTGATGAATCGGGCTCGCTCCGGTTAGGTTTGGCGGGTCTTTT
JMFF023A03+ TCCGGCGGGCATTGGGAGTGATGAATCGGGCTCGCTCCGGTTAGGTTTGGCGGGTCTTTT
JMSF002D12+ TCCGGCGGGCATTGGGAGTGATGAATCGGGCTCGCTCCGGTTAGGTTTGGCGGGTCTTTT
                      ____________________________________________________________
consensus TCCGGCGGGCATTGGGAGTGATGAATCGGGCTCGCTCCGGTTAGGTTTGGCGGGTCTTTT
 
. : . : . : . : . : . :
rJMFF023A03- CGGGGCGAGGGCGTCGAATTGAGCTCTGACTTGCTCGGCGATCTGAAGCTGCTGATCGGG
JMFF023A03+ CGGGGCGAGGGCGTCGAATTGAGCTCTGACTTGCTCGGCGATCTGAAGCTGCTGATCGGG
JMSF002D12+ CGGGGCGAGGGCGTCGAATTGAGCTCTGACTTGCTCGGCGATCTGAAGCTGCTGATCGGG
                      ____________________________________________________________
consensus CGGGGCGAGGGCGTCGAATTGAGCTCTGACTTGCTCGGCGATCTGAAGCTGCTGATCGGG
 
. : . : . : . : . : . :
rJMFF023A03- ATCTAAAATCTCGTCGCTCCGGCTGGGTTTTGACACCACCCGTCGTCCCACCATGGCTGA
JMFF023A03+ ATCTAAAATCTCGTCGCTCCGGCTGGGTTTTGACACCACCCGTCGTCCCACCATGGCTGA
JMSF002D12+ ATCTAAAATCTCGTCGCTCCGGCTGGGTTTTGACACCACCCGTCGTCCCACCATGGCTGA
                      ____________________________________________________________
consensus ATCTAAAATCTCGTCGCTCCGGCTGGGTTTTGACACCACCCGTCGTCCCACCATGGCTGA
 
. : . : . : . : . : . :
rJMFF023A03- CGTATCGACCAAATGACTATGCGGGTAACTGCCGC
JMFF023A03+ CGTATCGACCAAATGACTATGCGGTTAACTGCCGCCGATTCTCGGAAAGGGAAGACGACT
JMSF002D12+ CGTATCGACCAAATGACTATGCGGTTAACTGCCGCCGATTCTCGGAAAGGGAAGACGACT
                      ____________________________________________________________
consensus CGTATCGACCAAATGACTATGCGGTTAACTGCCGCCGATTCTCGGAAAGGGAAGACGACT
 
. : . : . : . : . : . :
JMFF023A03+ AATATTTTTTTCTCCTTCAGCTGTCGCAGTACAGTGTTAAGAAT
JMSF002D12+ AATATTTTTTTCTCCTTCAGCTGTCGCAGTACAGTGTTAAGAATTCTGGAATTTTCCTCA
                      ____________________________________________________________
consensus AATATTTTTTTCTCCTTCAGCTGTCGCAGTACAGTGTTAAGAATTCTGGAATTTTCCTCA